FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625608_at:

>probe:Drosophila_2:1625608_at:708:553; Interrogation_Position=110; Antisense; GGAGCTGACCCTGAAATCGGACTAT
>probe:Drosophila_2:1625608_at:507:689; Interrogation_Position=132; Antisense; TATTCCGCCGATTCTGTTATCGATG
>probe:Drosophila_2:1625608_at:587:401; Interrogation_Position=156; Antisense; GACATTATATCCAAGTCGCTGGCAT
>probe:Drosophila_2:1625608_at:725:581; Interrogation_Position=175; Antisense; TGGCATCCCAGGCAGTTCCAAGGAC
>probe:Drosophila_2:1625608_at:378:637; Interrogation_Position=227; Antisense; TCGATCCCTGGCCAAAGTTATAATG
>probe:Drosophila_2:1625608_at:210:229; Interrogation_Position=248; Antisense; AATGACTCTGATCGGAAACCTCAAG
>probe:Drosophila_2:1625608_at:244:405; Interrogation_Position=306; Antisense; GACTACTGGCGTAATCTGGCCGAGT
>probe:Drosophila_2:1625608_at:89:317; Interrogation_Position=324; Antisense; GCCGAGTCCCGTTTGGAGGTCAACA
>probe:Drosophila_2:1625608_at:508:529; Interrogation_Position=357; Antisense; GGGAGGTTTATCGAAGCCCAGCAAA
>probe:Drosophila_2:1625608_at:237:577; Interrogation_Position=382; Antisense; GGCGAATCTATACCCTGGAGACCAG
>probe:Drosophila_2:1625608_at:520:1; Interrogation_Position=424; Antisense; ATTTGGCCCGCGAGACCCAGAAAAT
>probe:Drosophila_2:1625608_at:421:421; Interrogation_Position=501; Antisense; GAGCACGCCGACTAGATTTAGCATA
>probe:Drosophila_2:1625608_at:199:93; Interrogation_Position=71; Antisense; AGTTCCGTACTTGCAGCTGAATTCT
>probe:Drosophila_2:1625608_at:625:333; Interrogation_Position=86; Antisense; GCTGAATTCTTTGATGGCTTCCATG

Paste this into a BLAST search page for me
GGAGCTGACCCTGAAATCGGACTATTATTCCGCCGATTCTGTTATCGATGGACATTATATCCAAGTCGCTGGCATTGGCATCCCAGGCAGTTCCAAGGACTCGATCCCTGGCCAAAGTTATAATGAATGACTCTGATCGGAAACCTCAAGGACTACTGGCGTAATCTGGCCGAGTGCCGAGTCCCGTTTGGAGGTCAACAGGGAGGTTTATCGAAGCCCAGCAAAGGCGAATCTATACCCTGGAGACCAGATTTGGCCCGCGAGACCCAGAAAATGAGCACGCCGACTAGATTTAGCATAAGTTCCGTACTTGCAGCTGAATTCTGCTGAATTCTTTGATGGCTTCCATG

Full Affymetrix probeset data:

Annotations for 1625608_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720