FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625609_at:

>probe:Drosophila_2:1625609_at:50:693; Interrogation_Position=255; Antisense; TTTGCCCTGGAAACCGTCGATGTCA
>probe:Drosophila_2:1625609_at:577:325; Interrogation_Position=292; Antisense; GCGATCCCGAGCTGAATAGTTTAAA
>probe:Drosophila_2:1625609_at:581:573; Interrogation_Position=322; Antisense; GGCTGTTTGTGGTAGTTCCCTTAAT
>probe:Drosophila_2:1625609_at:261:707; Interrogation_Position=342; Antisense; TTAATTCTGGCCTGCATCGGCTATG
>probe:Drosophila_2:1625609_at:74:485; Interrogation_Position=388; Antisense; GTATGCATACAGTGGCTAAACGGAC
>probe:Drosophila_2:1625609_at:372:215; Interrogation_Position=453; Antisense; AAGTACGGTCCGGAATACAAGCAGG
>probe:Drosophila_2:1625609_at:162:631; Interrogation_Position=511; Antisense; TCCTATTAACCACTGATCCATCCGA
>probe:Drosophila_2:1625609_at:605:511; Interrogation_Position=553; Antisense; GTGAAAGCAGCAATGCCCACTGGCT
>probe:Drosophila_2:1625609_at:283:259; Interrogation_Position=570; Antisense; CACTGGCTGCGCAAAACCGATAGAT
>probe:Drosophila_2:1625609_at:172:93; Interrogation_Position=620; Antisense; AGTTGGATCCCCACTCGGATATGAC
>probe:Drosophila_2:1625609_at:432:571; Interrogation_Position=696; Antisense; GGCTTTGTACCCTTCTAAGCAACAA
>probe:Drosophila_2:1625609_at:2:459; Interrogation_Position=725; Antisense; GATATGATCCTTCAATTCCGTTTAA
>probe:Drosophila_2:1625609_at:432:723; Interrogation_Position=753; Antisense; TTGAGACCTTTTTTGCGACTGGAAA
>probe:Drosophila_2:1625609_at:357:523; Interrogation_Position=790; Antisense; GGGCTTTCTCGTTTGGCGCAATAAA

Paste this into a BLAST search page for me
TTTGCCCTGGAAACCGTCGATGTCAGCGATCCCGAGCTGAATAGTTTAAAGGCTGTTTGTGGTAGTTCCCTTAATTTAATTCTGGCCTGCATCGGCTATGGTATGCATACAGTGGCTAAACGGACAAGTACGGTCCGGAATACAAGCAGGTCCTATTAACCACTGATCCATCCGAGTGAAAGCAGCAATGCCCACTGGCTCACTGGCTGCGCAAAACCGATAGATAGTTGGATCCCCACTCGGATATGACGGCTTTGTACCCTTCTAAGCAACAAGATATGATCCTTCAATTCCGTTTAATTGAGACCTTTTTTGCGACTGGAAAGGGCTTTCTCGTTTGGCGCAATAAA

Full Affymetrix probeset data:

Annotations for 1625609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720