FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625611_at:

>probe:Drosophila_2:1625611_at:141:111; Interrogation_Position=1000; Antisense; AGAATACGACGACCTGTCTGCCGGA
>probe:Drosophila_2:1625611_at:627:709; Interrogation_Position=1080; Antisense; TTCAAGGGCTACGTCCGGAATCGGG
>probe:Drosophila_2:1625611_at:719:125; Interrogation_Position=1203; Antisense; ACCTACCAGCGTTGCGAGTACGGAT
>probe:Drosophila_2:1625611_at:719:669; Interrogation_Position=1221; Antisense; TACGGATTGTGCAACGCCATGGGAA
>probe:Drosophila_2:1625611_at:281:313; Interrogation_Position=1255; Antisense; GCCAGGTGGGCATGACGCGATTCAT
>probe:Drosophila_2:1625611_at:468:27; Interrogation_Position=1313; Antisense; ATACGCCTCTATGAATCCCGTCAAG
>probe:Drosophila_2:1625611_at:666:613; Interrogation_Position=1339; Antisense; TGAACGCATCGCTCATCCAGGAATT
>probe:Drosophila_2:1625611_at:280:565; Interrogation_Position=1358; Antisense; GGAATTCAATCTTCTGCTGGGCAGG
>probe:Drosophila_2:1625611_at:180:621; Interrogation_Position=1372; Antisense; TGCTGGGCAGGCACTTCAACTTGAC
>probe:Drosophila_2:1625611_at:81:191; Interrogation_Position=1389; Antisense; AACTTGACCACACTCAGCGATATGT
>probe:Drosophila_2:1625611_at:183:607; Interrogation_Position=1422; Antisense; TGAGTTCGGAGCTCTCACTTTTCCA
>probe:Drosophila_2:1625611_at:635:701; Interrogation_Position=1440; Antisense; TTTTCCAGCATCACTGAGCAGTCTC
>probe:Drosophila_2:1625611_at:463:383; Interrogation_Position=899; Antisense; GAACGGCATCACCTGCGAAGGCGAT
>probe:Drosophila_2:1625611_at:212:413; Interrogation_Position=932; Antisense; GACCTGCGAGAATGGCTTCTGTGCA

Paste this into a BLAST search page for me
AGAATACGACGACCTGTCTGCCGGATTCAAGGGCTACGTCCGGAATCGGGACCTACCAGCGTTGCGAGTACGGATTACGGATTGTGCAACGCCATGGGAAGCCAGGTGGGCATGACGCGATTCATATACGCCTCTATGAATCCCGTCAAGTGAACGCATCGCTCATCCAGGAATTGGAATTCAATCTTCTGCTGGGCAGGTGCTGGGCAGGCACTTCAACTTGACAACTTGACCACACTCAGCGATATGTTGAGTTCGGAGCTCTCACTTTTCCATTTTCCAGCATCACTGAGCAGTCTCGAACGGCATCACCTGCGAAGGCGATGACCTGCGAGAATGGCTTCTGTGCA

Full Affymetrix probeset data:

Annotations for 1625611_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720