Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625614_at:

>probe:Drosophila_2:1625614_at:118:525; Interrogation_Position=1024; Antisense; GGGAAACTAACCTACGAGGCCATGA
>probe:Drosophila_2:1625614_at:594:65; Interrogation_Position=1048; Antisense; ATGGAGATGCCCTACTTGGACCAGA
>probe:Drosophila_2:1625614_at:667:723; Interrogation_Position=1063; Antisense; TTGGACCAGACCATCACAGGTATGT
>probe:Drosophila_2:1625614_at:184:517; Interrogation_Position=1094; Antisense; GGTGGAAACTCTGCGCAAGTACCCG
>probe:Drosophila_2:1625614_at:484:571; Interrogation_Position=1118; Antisense; GGCTCTTAGTTCACTTACACGTCTC
>probe:Drosophila_2:1625614_at:154:499; Interrogation_Position=1138; Antisense; GTCTCGCCTCCGAGGACTATGAGAT
>probe:Drosophila_2:1625614_at:133:223; Interrogation_Position=1200; Antisense; AAGGGCACCAGTGTGCACATTCCGG
>probe:Drosophila_2:1625614_at:124:555; Interrogation_Position=1280; Antisense; GGAGCGATTTGCACCGGATGCCTGC
>probe:Drosophila_2:1625614_at:677:371; Interrogation_Position=1388; Antisense; GAAGGTGGGCCTGATCACGCTGCTC
>probe:Drosophila_2:1625614_at:429:287; Interrogation_Position=1439; Antisense; CGGATCGCCAACTCAGCTGAAGGTG
>probe:Drosophila_2:1625614_at:562:99; Interrogation_Position=1468; Antisense; AGAGGAATTTGATACTCCTGCCCAG
>probe:Drosophila_2:1625614_at:317:501; Interrogation_Position=1500; Antisense; GTCCGATTGCAAGTCGATCCAGTCG
>probe:Drosophila_2:1625614_at:512:47; Interrogation_Position=1516; Antisense; ATCCAGTCGAGTCGCGCCTAATGTA
>probe:Drosophila_2:1625614_at:83:673; Interrogation_Position=943; Antisense; TACGCCCTATTCGAGTTGGCCAAAA

Paste this into a BLAST search page for me
GGGAAACTAACCTACGAGGCCATGAATGGAGATGCCCTACTTGGACCAGATTGGACCAGACCATCACAGGTATGTGGTGGAAACTCTGCGCAAGTACCCGGGCTCTTAGTTCACTTACACGTCTCGTCTCGCCTCCGAGGACTATGAGATAAGGGCACCAGTGTGCACATTCCGGGGAGCGATTTGCACCGGATGCCTGCGAAGGTGGGCCTGATCACGCTGCTCCGGATCGCCAACTCAGCTGAAGGTGAGAGGAATTTGATACTCCTGCCCAGGTCCGATTGCAAGTCGATCCAGTCGATCCAGTCGAGTCGCGCCTAATGTATACGCCCTATTCGAGTTGGCCAAAA

Full Affymetrix probeset data:

Annotations for 1625614_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime