FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625616_at:

>probe:Drosophila_2:1625616_at:414:657; Interrogation_Position=101; Antisense; TAAGCCGCGGACGTTCGAGGTACTC
>probe:Drosophila_2:1625616_at:416:67; Interrogation_Position=13; Antisense; ATGGCAAAGCTCCAGGTTATCCTTA
>probe:Drosophila_2:1625616_at:333:285; Interrogation_Position=149; Antisense; CTGACGCAGCTGATCCGGATGCCGT
>probe:Drosophila_2:1625616_at:113:279; Interrogation_Position=180; Antisense; CTATCCCTCGGCAGATGAGCTGAAG
>probe:Drosophila_2:1625616_at:70:547; Interrogation_Position=258; Antisense; GGATGCCGTCTATGGACCGCCCGAT
>probe:Drosophila_2:1625616_at:477:79; Interrogation_Position=26; Antisense; AGGTTATCCTTATTGCTGCAGCCCT
>probe:Drosophila_2:1625616_at:522:187; Interrogation_Position=292; Antisense; AACAGCGTTCCCGACGAGGTCTACG
>probe:Drosophila_2:1625616_at:635:553; Interrogation_Position=324; Antisense; GGACGTGACCGGAAACGATCTGCCC
>probe:Drosophila_2:1625616_at:357:713; Interrogation_Position=362; Antisense; TTCCGGCGGAGCAGCAGGCCCGTTT
>probe:Drosophila_2:1625616_at:427:267; Interrogation_Position=376; Antisense; CAGGCCCGTTTGGTAGCTGCCAGGA
>probe:Drosophila_2:1625616_at:589:81; Interrogation_Position=400; Antisense; AGGGCCGCCAACTACCGGAGAGTAG
>probe:Drosophila_2:1625616_at:298:551; Interrogation_Position=416; Antisense; GGAGAGTAGCTAAGCCCGTGGCCTA
>probe:Drosophila_2:1625616_at:612:205; Interrogation_Position=71; Antisense; AAGCCCAGCAACAGCGCTATTCGCA
>probe:Drosophila_2:1625616_at:457:689; Interrogation_Position=88; Antisense; TATTCGCAGCGCCTAAGCCGCGGAC

Paste this into a BLAST search page for me
TAAGCCGCGGACGTTCGAGGTACTCATGGCAAAGCTCCAGGTTATCCTTACTGACGCAGCTGATCCGGATGCCGTCTATCCCTCGGCAGATGAGCTGAAGGGATGCCGTCTATGGACCGCCCGATAGGTTATCCTTATTGCTGCAGCCCTAACAGCGTTCCCGACGAGGTCTACGGGACGTGACCGGAAACGATCTGCCCTTCCGGCGGAGCAGCAGGCCCGTTTCAGGCCCGTTTGGTAGCTGCCAGGAAGGGCCGCCAACTACCGGAGAGTAGGGAGAGTAGCTAAGCCCGTGGCCTAAAGCCCAGCAACAGCGCTATTCGCATATTCGCAGCGCCTAAGCCGCGGAC

Full Affymetrix probeset data:

Annotations for 1625616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720