FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625617_at:

>probe:Drosophila_2:1625617_at:666:173; Interrogation_Position=132; Antisense; AAACCGAATCTCATTAGCCCAGTGG
>probe:Drosophila_2:1625617_at:318:123; Interrogation_Position=147; Antisense; AGCCCAGTGGATTGGTCAGTTTCCC
>probe:Drosophila_2:1625617_at:720:693; Interrogation_Position=16; Antisense; TTTCCCTTGTTTTGGTGTGGCCACA
>probe:Drosophila_2:1625617_at:217:479; Interrogation_Position=165; Antisense; GTTTCCCAGACTTTTTTGACATGGC
>probe:Drosophila_2:1625617_at:677:541; Interrogation_Position=211; Antisense; GGATAGGCCCACAGACGACGGAGAT
>probe:Drosophila_2:1625617_at:611:233; Interrogation_Position=306; Antisense; AATGCGATATCTGTGCCATTTGCCG
>probe:Drosophila_2:1625617_at:412:505; Interrogation_Position=318; Antisense; GTGCCATTTGCCGTGTTCAAGTTAT
>probe:Drosophila_2:1625617_at:714:215; Interrogation_Position=336; Antisense; AAGTTATGGATTCCTGCCTTCGCTG
>probe:Drosophila_2:1625617_at:431:257; Interrogation_Position=37; Antisense; CACACTGACTTTTGGCTTGCTATTG
>probe:Drosophila_2:1625617_at:713:143; Interrogation_Position=441; Antisense; ACTGCTGCATGTCGCTGTGGGTCAA
>probe:Drosophila_2:1625617_at:158:495; Interrogation_Position=461; Antisense; GTCAAGCAGAACAACCGATGCCCGT
>probe:Drosophila_2:1625617_at:90:295; Interrogation_Position=476; Antisense; CGATGCCCGTTGTGCCAGCAGGAGT
>probe:Drosophila_2:1625617_at:147:83; Interrogation_Position=498; Antisense; AGTGGTCCATTCAGCGCATGGGAAA
>probe:Drosophila_2:1625617_at:85:19; Interrogation_Position=75; Antisense; ATTTCGACTTCTTATTTGTTGGAGG

Paste this into a BLAST search page for me
AAACCGAATCTCATTAGCCCAGTGGAGCCCAGTGGATTGGTCAGTTTCCCTTTCCCTTGTTTTGGTGTGGCCACAGTTTCCCAGACTTTTTTGACATGGCGGATAGGCCCACAGACGACGGAGATAATGCGATATCTGTGCCATTTGCCGGTGCCATTTGCCGTGTTCAAGTTATAAGTTATGGATTCCTGCCTTCGCTGCACACTGACTTTTGGCTTGCTATTGACTGCTGCATGTCGCTGTGGGTCAAGTCAAGCAGAACAACCGATGCCCGTCGATGCCCGTTGTGCCAGCAGGAGTAGTGGTCCATTCAGCGCATGGGAAAATTTCGACTTCTTATTTGTTGGAGG

Full Affymetrix probeset data:

Annotations for 1625617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720