Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625618_at:

>probe:Drosophila_2:1625618_at:12:455; Interrogation_Position=2038; Antisense; GATACAGTGGTCCAGAATCGCACCA
>probe:Drosophila_2:1625618_at:697:145; Interrogation_Position=2062; Antisense; ACTCTGGTGATTGCCCATCGCTTGT
>probe:Drosophila_2:1625618_at:116:633; Interrogation_Position=2079; Antisense; TCGCTTGTCCACGATACGAAACGCT
>probe:Drosophila_2:1625618_at:190:455; Interrogation_Position=2091; Antisense; GATACGAAACGCTGACCTCATTGTC
>probe:Drosophila_2:1625618_at:149:611; Interrogation_Position=2103; Antisense; TGACCTCATTGTCGTCCTTGATCAG
>probe:Drosophila_2:1625618_at:26:631; Interrogation_Position=2117; Antisense; TCCTTGATCAGGGACGCGTCGTGGA
>probe:Drosophila_2:1625618_at:478:103; Interrogation_Position=2141; Antisense; AGACCGGCAAACATGACGAACTGAT
>probe:Drosophila_2:1625618_at:134:577; Interrogation_Position=2176; Antisense; GGCCTGTACTTTGAGCTGGTGCGTC
>probe:Drosophila_2:1625618_at:540:495; Interrogation_Position=2198; Antisense; GTCAGCAGGAACGACGGGACATCCA
>probe:Drosophila_2:1625618_at:253:153; Interrogation_Position=2216; Antisense; ACATCCAGGAGCAAGTCCAGGCGGT
>probe:Drosophila_2:1625618_at:342:359; Interrogation_Position=2299; Antisense; GCAACAATTGCAACTGCCGCAGAAA
>probe:Drosophila_2:1625618_at:554:263; Interrogation_Position=2352; Antisense; CAGCAGCTTCGGTGGCAGGGCAAAC
>probe:Drosophila_2:1625618_at:304:353; Interrogation_Position=2377; Antisense; GCAGCGCAAGGATAGTGACGATGTT
>probe:Drosophila_2:1625618_at:25:367; Interrogation_Position=2411; Antisense; GAATGATTCCCTATACACTTAATTT

Paste this into a BLAST search page for me
GATACAGTGGTCCAGAATCGCACCAACTCTGGTGATTGCCCATCGCTTGTTCGCTTGTCCACGATACGAAACGCTGATACGAAACGCTGACCTCATTGTCTGACCTCATTGTCGTCCTTGATCAGTCCTTGATCAGGGACGCGTCGTGGAAGACCGGCAAACATGACGAACTGATGGCCTGTACTTTGAGCTGGTGCGTCGTCAGCAGGAACGACGGGACATCCAACATCCAGGAGCAAGTCCAGGCGGTGCAACAATTGCAACTGCCGCAGAAACAGCAGCTTCGGTGGCAGGGCAAACGCAGCGCAAGGATAGTGACGATGTTGAATGATTCCCTATACACTTAATTT

Full Affymetrix probeset data:

Annotations for 1625618_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime