FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625619_at:

>probe:Drosophila_2:1625619_at:326:329; Interrogation_Position=1035; Antisense; GCGGTCACAGCAGGGAGTGTCTACC
>probe:Drosophila_2:1625619_at:260:201; Interrogation_Position=1071; Antisense; AACGCGCCATTCAACTTGCCAAATT
>probe:Drosophila_2:1625619_at:104:313; Interrogation_Position=1088; Antisense; GCCAAATTGAACGTGGAGCGCGATT
>probe:Drosophila_2:1625619_at:309:149; Interrogation_Position=1143; Antisense; ACATAACTCTGACGGTATTCGAAGC
>probe:Drosophila_2:1625619_at:528:689; Interrogation_Position=1158; Antisense; TATTCGAAGCTTACATACCGCGGTT
>probe:Drosophila_2:1625619_at:637:25; Interrogation_Position=1172; Antisense; ATACCGCGGTTCTTCAAGGGAGTCA
>probe:Drosophila_2:1625619_at:693:353; Interrogation_Position=672; Antisense; GCACCCGTTCTCCTAAAGAGCAAAT
>probe:Drosophila_2:1625619_at:51:665; Interrogation_Position=699; Antisense; TACAGGCTATTTGGGTGACCGAACT
>probe:Drosophila_2:1625619_at:54:275; Interrogation_Position=749; Antisense; CATTGCAATTGGTTGGATTTCCGCA
>probe:Drosophila_2:1625619_at:701:541; Interrogation_Position=763; Antisense; GGATTTCCGCAGATATCAGCTACCA
>probe:Drosophila_2:1625619_at:308:151; Interrogation_Position=798; Antisense; ACATTAACTTGGTTCGCGATCCTGT
>probe:Drosophila_2:1625619_at:151:409; Interrogation_Position=885; Antisense; GACGATTTCCCAACGCAACAATTAA
>probe:Drosophila_2:1625619_at:13:3; Interrogation_Position=942; Antisense; ATTGTGTTCGTAGTGGTGACCCCGA
>probe:Drosophila_2:1625619_at:47:515; Interrogation_Position=967; Antisense; GTGTCAGTACGTGCCTGGAAGCATT

Paste this into a BLAST search page for me
GCGGTCACAGCAGGGAGTGTCTACCAACGCGCCATTCAACTTGCCAAATTGCCAAATTGAACGTGGAGCGCGATTACATAACTCTGACGGTATTCGAAGCTATTCGAAGCTTACATACCGCGGTTATACCGCGGTTCTTCAAGGGAGTCAGCACCCGTTCTCCTAAAGAGCAAATTACAGGCTATTTGGGTGACCGAACTCATTGCAATTGGTTGGATTTCCGCAGGATTTCCGCAGATATCAGCTACCAACATTAACTTGGTTCGCGATCCTGTGACGATTTCCCAACGCAACAATTAAATTGTGTTCGTAGTGGTGACCCCGAGTGTCAGTACGTGCCTGGAAGCATT

Full Affymetrix probeset data:

Annotations for 1625619_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720