Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625623_at:

>probe:Drosophila_2:1625623_at:442:657; Interrogation_Position=5046; Antisense; TAAGGGCGGCAGAATTAACTCGATC
>probe:Drosophila_2:1625623_at:469:285; Interrogation_Position=5066; Antisense; CGATCGAGGAGGAGCGTACCGCCAT
>probe:Drosophila_2:1625623_at:723:653; Interrogation_Position=5093; Antisense; TAATCGGCATAGTGGCGGGCATACT
>probe:Drosophila_2:1625623_at:476:669; Interrogation_Position=5114; Antisense; TACTGATCGCAGTGGTGCTGGTCAT
>probe:Drosophila_2:1625623_at:187:591; Interrogation_Position=5144; Antisense; TGGTCCTGTGGCTCAAGTCGAATGG
>probe:Drosophila_2:1625623_at:377:87; Interrogation_Position=5159; Antisense; AGTCGAATGGCGATCGTGGCTACAA
>probe:Drosophila_2:1625623_at:271:669; Interrogation_Position=5209; Antisense; TACGGTTCCCACAATCCGAATGCTG
>probe:Drosophila_2:1625623_at:504:303; Interrogation_Position=5224; Antisense; CCGAATGCTGCACTCCTGGGAAATA
>probe:Drosophila_2:1625623_at:149:675; Interrogation_Position=5250; Antisense; TAGCACCAATGGATCGTACCACCAG
>probe:Drosophila_2:1625623_at:495:353; Interrogation_Position=5274; Antisense; GCAGCGGCAGCACCATATGCATGGT
>probe:Drosophila_2:1625623_at:302:443; Interrogation_Position=5406; Antisense; GATGTCCAGCGGAAGTGGGTCACTT
>probe:Drosophila_2:1625623_at:613:221; Interrogation_Position=5418; Antisense; AAGTGGGTCACTTGGCTATGGCAGC
>probe:Drosophila_2:1625623_at:617:225; Interrogation_Position=5479; Antisense; AAGGCCAAGAAACGCGACTCCAAGG
>probe:Drosophila_2:1625623_at:702:535; Interrogation_Position=5535; Antisense; GGTCGCAGGGAAATATCGTCAAATT

Paste this into a BLAST search page for me
TAAGGGCGGCAGAATTAACTCGATCCGATCGAGGAGGAGCGTACCGCCATTAATCGGCATAGTGGCGGGCATACTTACTGATCGCAGTGGTGCTGGTCATTGGTCCTGTGGCTCAAGTCGAATGGAGTCGAATGGCGATCGTGGCTACAATACGGTTCCCACAATCCGAATGCTGCCGAATGCTGCACTCCTGGGAAATATAGCACCAATGGATCGTACCACCAGGCAGCGGCAGCACCATATGCATGGTGATGTCCAGCGGAAGTGGGTCACTTAAGTGGGTCACTTGGCTATGGCAGCAAGGCCAAGAAACGCGACTCCAAGGGGTCGCAGGGAAATATCGTCAAATT

Full Affymetrix probeset data:

Annotations for 1625623_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime