FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625624_at:

>probe:Drosophila_2:1625624_at:580:453; Interrogation_Position=148; Antisense; GATACCCAGGCTATCAAAGCTTCCA
>probe:Drosophila_2:1625624_at:141:283; Interrogation_Position=15; Antisense; GCCGCAGGCCAATCTTACGTTAAGT
>probe:Drosophila_2:1625624_at:544:181; Interrogation_Position=186; Antisense; AAAAGCCATCGCCTTATCCGAAAGC
>probe:Drosophila_2:1625624_at:550:265; Interrogation_Position=262; Antisense; CAGAGGGCTTCCGTGCTTAATAATC
>probe:Drosophila_2:1625624_at:372:145; Interrogation_Position=295; Antisense; ACTTTACGCCTAGCCAAACGTGATG
>probe:Drosophila_2:1625624_at:579:605; Interrogation_Position=318; Antisense; TGAGGAGGCCCTCGATGACCTAAAC
>probe:Drosophila_2:1625624_at:65:473; Interrogation_Position=33; Antisense; GTTAAGTCCCCATGATCAGCAGGTG
>probe:Drosophila_2:1625624_at:578:219; Interrogation_Position=382; Antisense; AAGTGCCATGCCCATTGTCAGCGAG
>probe:Drosophila_2:1625624_at:658:495; Interrogation_Position=398; Antisense; GTCAGCGAGGTGTCCTTTATCGTAA
>probe:Drosophila_2:1625624_at:413:141; Interrogation_Position=423; Antisense; ACTGGATAACTTGGAGGCGGCTCGT
>probe:Drosophila_2:1625624_at:699:113; Interrogation_Position=50; Antisense; AGCAGGTGCTCGATTCCATTTTCAA
>probe:Drosophila_2:1625624_at:701:559; Interrogation_Position=504; Antisense; GGAAATCAATCCCTATGCAGCTCTC
>probe:Drosophila_2:1625624_at:203:639; Interrogation_Position=527; Antisense; TCTGCAATCAAATGCTCCGTCAGGC
>probe:Drosophila_2:1625624_at:221:291; Interrogation_Position=544; Antisense; CGTCAGGCATTCGATCAACTCAAGT

Paste this into a BLAST search page for me
GATACCCAGGCTATCAAAGCTTCCAGCCGCAGGCCAATCTTACGTTAAGTAAAAGCCATCGCCTTATCCGAAAGCCAGAGGGCTTCCGTGCTTAATAATCACTTTACGCCTAGCCAAACGTGATGTGAGGAGGCCCTCGATGACCTAAACGTTAAGTCCCCATGATCAGCAGGTGAAGTGCCATGCCCATTGTCAGCGAGGTCAGCGAGGTGTCCTTTATCGTAAACTGGATAACTTGGAGGCGGCTCGTAGCAGGTGCTCGATTCCATTTTCAAGGAAATCAATCCCTATGCAGCTCTCTCTGCAATCAAATGCTCCGTCAGGCCGTCAGGCATTCGATCAACTCAAGT

Full Affymetrix probeset data:

Annotations for 1625624_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720