FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625625_at:

>probe:Drosophila_2:1625625_at:692:265; Interrogation_Position=5469; Antisense; CAGATTCCCTTTGAGCCAGTGATGT
>probe:Drosophila_2:1625625_at:377:479; Interrogation_Position=5492; Antisense; GTTTGTCAATTGAGCCACTGGGCAC
>probe:Drosophila_2:1625625_at:47:527; Interrogation_Position=5511; Antisense; GGGCACAACCCCAATCCACATATGA
>probe:Drosophila_2:1625625_at:149:23; Interrogation_Position=5530; Antisense; ATATGACACCACACGCCACAAAGGA
>probe:Drosophila_2:1625625_at:312:695; Interrogation_Position=5587; Antisense; TTTCGACTATTTATTCTACTCATCT
>probe:Drosophila_2:1625625_at:21:689; Interrogation_Position=5598; Antisense; TATTCTACTCATCTAAACCATCAAA
>probe:Drosophila_2:1625625_at:386:53; Interrogation_Position=5675; Antisense; ATGAATTCTTCATTTAGCTTAGTTT
>probe:Drosophila_2:1625625_at:95:3; Interrogation_Position=5727; Antisense; ATTGGCCAGGCAAACCAGTAACCGA
>probe:Drosophila_2:1625625_at:457:177; Interrogation_Position=5834; Antisense; AAACGTGTTCGATGTACATGATAAA
>probe:Drosophila_2:1625625_at:188:663; Interrogation_Position=5900; Antisense; TAAACAATCCGATCATATCCCCTAT
>probe:Drosophila_2:1625625_at:362:453; Interrogation_Position=5910; Antisense; GATCATATCCCCTATATAGTTTATT
>probe:Drosophila_2:1625625_at:137:601; Interrogation_Position=5938; Antisense; TGTACGTGCGTGTGAGAGACACTCA
>probe:Drosophila_2:1625625_at:218:651; Interrogation_Position=5960; Antisense; TCACACACTTTTCTCACAGTCAAGA
>probe:Drosophila_2:1625625_at:238:155; Interrogation_Position=5975; Antisense; ACAGTCAAGACGCATCACAGTAAAA

Paste this into a BLAST search page for me
CAGATTCCCTTTGAGCCAGTGATGTGTTTGTCAATTGAGCCACTGGGCACGGGCACAACCCCAATCCACATATGAATATGACACCACACGCCACAAAGGATTTCGACTATTTATTCTACTCATCTTATTCTACTCATCTAAACCATCAAAATGAATTCTTCATTTAGCTTAGTTTATTGGCCAGGCAAACCAGTAACCGAAAACGTGTTCGATGTACATGATAAATAAACAATCCGATCATATCCCCTATGATCATATCCCCTATATAGTTTATTTGTACGTGCGTGTGAGAGACACTCATCACACACTTTTCTCACAGTCAAGAACAGTCAAGACGCATCACAGTAAAA

Full Affymetrix probeset data:

Annotations for 1625625_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720