Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625626_at:

>probe:Drosophila_2:1625626_at:411:437; Interrogation_Position=109; Antisense; GAGGACGATTACGACCAAGTCAGCG
>probe:Drosophila_2:1625626_at:730:251; Interrogation_Position=124; Antisense; CAAGTCAGCGGCTCTGGTTCAGATA
>probe:Drosophila_2:1625626_at:197:245; Interrogation_Position=181; Antisense; AATTCATCCTCCTCCATAGCAAAGG
>probe:Drosophila_2:1625626_at:248:145; Interrogation_Position=226; Antisense; ACTCGCAATCAGAAATCGTCGTCAG
>probe:Drosophila_2:1625626_at:555:433; Interrogation_Position=253; Antisense; GAGGTGGACAGTTCTTCCGAGGATT
>probe:Drosophila_2:1625626_at:542:177; Interrogation_Position=281; Antisense; AAACGGAATCTCGTGTTGCCAGAAA
>probe:Drosophila_2:1625626_at:185:169; Interrogation_Position=303; Antisense; AAAGGGCGTGGCTTCACTCATTGAA
>probe:Drosophila_2:1625626_at:662:261; Interrogation_Position=374; Antisense; CAGCCATTATGCTTGATCAGACCAA
>probe:Drosophila_2:1625626_at:313:685; Interrogation_Position=407; Antisense; TATCCCGCCGCGATCAAGATCAGAG
>probe:Drosophila_2:1625626_at:584:95; Interrogation_Position=423; Antisense; AGATCAGAGTGCTCGCAAGCGTTAC
>probe:Drosophila_2:1625626_at:689:215; Interrogation_Position=43; Antisense; AAGTTCCTTAGCTACAAGGGTCGCA
>probe:Drosophila_2:1625626_at:190:267; Interrogation_Position=498; Antisense; CAGGCTGGCTCTGATCCGGAAGCAG
>probe:Drosophila_2:1625626_at:352:209; Interrogation_Position=527; Antisense; AAGAAACCGCTGCTAGGCGTGAAGC
>probe:Drosophila_2:1625626_at:213:209; Interrogation_Position=560; Antisense; AAGCAGCCAATGTGGTCACCAAGAA

Paste this into a BLAST search page for me
GAGGACGATTACGACCAAGTCAGCGCAAGTCAGCGGCTCTGGTTCAGATAAATTCATCCTCCTCCATAGCAAAGGACTCGCAATCAGAAATCGTCGTCAGGAGGTGGACAGTTCTTCCGAGGATTAAACGGAATCTCGTGTTGCCAGAAAAAAGGGCGTGGCTTCACTCATTGAACAGCCATTATGCTTGATCAGACCAATATCCCGCCGCGATCAAGATCAGAGAGATCAGAGTGCTCGCAAGCGTTACAAGTTCCTTAGCTACAAGGGTCGCACAGGCTGGCTCTGATCCGGAAGCAGAAGAAACCGCTGCTAGGCGTGAAGCAAGCAGCCAATGTGGTCACCAAGAA

Full Affymetrix probeset data:

Annotations for 1625626_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime