FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625629_at:

>probe:Drosophila_2:1625629_at:365:577; Interrogation_Position=1260; Antisense; GGCCGATGTCCTCGTTAAGTATCAC
>probe:Drosophila_2:1625629_at:215:711; Interrogation_Position=1274; Antisense; TTAAGTATCACTATGGACCGCGCGG
>probe:Drosophila_2:1625629_at:67:413; Interrogation_Position=1289; Antisense; GACCGCGCGGTATCACCAAGAGTAA
>probe:Drosophila_2:1625629_at:730:473; Interrogation_Position=1340; Antisense; GTTACAAGTTATTCTGGCACGGCAT
>probe:Drosophila_2:1625629_at:423:29; Interrogation_Position=1363; Antisense; ATACATAGGGTGGTCCTCTCCAGAT
>probe:Drosophila_2:1625629_at:19:673; Interrogation_Position=1411; Antisense; TATCTGTACCGGTTCGACTTCGATT
>probe:Drosophila_2:1625629_at:143:619; Interrogation_Position=1424; Antisense; TCGACTTCGATTCGCCCAAGTTGAA
>probe:Drosophila_2:1625629_at:193:39; Interrogation_Position=1448; Antisense; ATCTGATGAGGAACCAGCTCTGCGG
>probe:Drosophila_2:1625629_at:92:575; Interrogation_Position=1471; Antisense; GGCGATGACATCAAACGCGGTGTTT
>probe:Drosophila_2:1625629_at:646:537; Interrogation_Position=1514; Antisense; GGTACATTTTCCACAAGCAGGCCCA
>probe:Drosophila_2:1625629_at:408:413; Interrogation_Position=1572; Antisense; GACCATCCAGCGTATGGTGGGCATA
>probe:Drosophila_2:1625629_at:475:19; Interrogation_Position=1594; Antisense; ATATTGACCACGTTTGCCAGGACCG
>probe:Drosophila_2:1625629_at:238:573; Interrogation_Position=1618; Antisense; GGCGATCCCAATTGTCCGGAGACGG
>probe:Drosophila_2:1625629_at:700:169; Interrogation_Position=1671; Antisense; AAAGTCTCCCTTCAAGGCATTGAAT

Paste this into a BLAST search page for me
GGCCGATGTCCTCGTTAAGTATCACTTAAGTATCACTATGGACCGCGCGGGACCGCGCGGTATCACCAAGAGTAAGTTACAAGTTATTCTGGCACGGCATATACATAGGGTGGTCCTCTCCAGATTATCTGTACCGGTTCGACTTCGATTTCGACTTCGATTCGCCCAAGTTGAAATCTGATGAGGAACCAGCTCTGCGGGGCGATGACATCAAACGCGGTGTTTGGTACATTTTCCACAAGCAGGCCCAGACCATCCAGCGTATGGTGGGCATAATATTGACCACGTTTGCCAGGACCGGGCGATCCCAATTGTCCGGAGACGGAAAGTCTCCCTTCAAGGCATTGAAT

Full Affymetrix probeset data:

Annotations for 1625629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720