FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625630_at:

>probe:Drosophila_2:1625630_at:39:241; Interrogation_Position=137; Antisense; AATATGATTATCCACCCGTACTACC
>probe:Drosophila_2:1625630_at:169:217; Interrogation_Position=212; Antisense; AAGTTGGACGGCCATCATTTGGCTC
>probe:Drosophila_2:1625630_at:614:19; Interrogation_Position=228; Antisense; ATTTGGCTCCAGTTGTTCTTGGCAA
>probe:Drosophila_2:1625630_at:688:713; Interrogation_Position=243; Antisense; TTCTTGGCAATTCCTCGCTGGAGGT
>probe:Drosophila_2:1625630_at:286:593; Interrogation_Position=323; Antisense; TGGGTCATTTCATAGCATGTTGCTT
>probe:Drosophila_2:1625630_at:710:273; Interrogation_Position=345; Antisense; CTTGTGAATGTCGAACTGCGGCCAT
>probe:Drosophila_2:1625630_at:598:227; Interrogation_Position=401; Antisense; AATGGCTGCTAGACCCGAAAACGAG
>probe:Drosophila_2:1625630_at:577:197; Interrogation_Position=420; Antisense; AACGAGGACCTCATATGTGTAAAGT
>probe:Drosophila_2:1625630_at:25:535; Interrogation_Position=480; Antisense; GGTCCACTTTTTTGCGATGGTCAGC
>probe:Drosophila_2:1625630_at:134:585; Interrogation_Position=509; Antisense; TGGAATAGCTCTGGGCTCCATCAAT
>probe:Drosophila_2:1625630_at:215:247; Interrogation_Position=531; Antisense; AATTGCTCCAGTCCAGATCCAGTTT
>probe:Drosophila_2:1625630_at:590:471; Interrogation_Position=572; Antisense; GTTCTACAACAGCTGGGTGACCAAA
>probe:Drosophila_2:1625630_at:622:413; Interrogation_Position=615; Antisense; GACCATACCAGACCATTTATCGCAG
>probe:Drosophila_2:1625630_at:434:399; Interrogation_Position=639; Antisense; GACAGATTTTCCTTATTTTCCTTCA

Paste this into a BLAST search page for me
AATATGATTATCCACCCGTACTACCAAGTTGGACGGCCATCATTTGGCTCATTTGGCTCCAGTTGTTCTTGGCAATTCTTGGCAATTCCTCGCTGGAGGTTGGGTCATTTCATAGCATGTTGCTTCTTGTGAATGTCGAACTGCGGCCATAATGGCTGCTAGACCCGAAAACGAGAACGAGGACCTCATATGTGTAAAGTGGTCCACTTTTTTGCGATGGTCAGCTGGAATAGCTCTGGGCTCCATCAATAATTGCTCCAGTCCAGATCCAGTTTGTTCTACAACAGCTGGGTGACCAAAGACCATACCAGACCATTTATCGCAGGACAGATTTTCCTTATTTTCCTTCA

Full Affymetrix probeset data:

Annotations for 1625630_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720