Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625631_at:

>probe:Drosophila_2:1625631_at:24:57; Interrogation_Position=143; Antisense; ATGAGGATAAGTTTCGCCGTGCGAA
>probe:Drosophila_2:1625631_at:235:183; Interrogation_Position=183; Antisense; AAAACCGCTACCTGATCGAGATTTG
>probe:Drosophila_2:1625631_at:379:627; Interrogation_Position=253; Antisense; TCCTTGCGGAATGCCTGGCGTTTAA
>probe:Drosophila_2:1625631_at:111:655; Interrogation_Position=275; Antisense; TAATTGAGCCATTTCAGCGCCGATT
>probe:Drosophila_2:1625631_at:50:711; Interrogation_Position=335; Antisense; TTAACCTGAGTAAGCTGCACGGGCA
>probe:Drosophila_2:1625631_at:410:333; Interrogation_Position=378; Antisense; GCTGATGTCAAAGCTGGTCCAAACA
>probe:Drosophila_2:1625631_at:468:589; Interrogation_Position=404; Antisense; TGGATTGCAATCTAGCTTTCCGCTT
>probe:Drosophila_2:1625631_at:297:315; Interrogation_Position=430; Antisense; GCCTTGGATGAGAATCTTCCCACAC
>probe:Drosophila_2:1625631_at:141:371; Interrogation_Position=462; Antisense; GAATGGCATCGATCCGGATTATATG
>probe:Drosophila_2:1625631_at:422:15; Interrogation_Position=479; Antisense; ATTATATGAGGATGCTGGCCACCGC
>probe:Drosophila_2:1625631_at:514:213; Interrogation_Position=508; Antisense; AAGAGTTATATCCTTGCGTCTTCCG
>probe:Drosophila_2:1625631_at:235:711; Interrogation_Position=555; Antisense; TTCACTAAGCAATGGTCTGGCCCGT
>probe:Drosophila_2:1625631_at:5:95; Interrogation_Position=587; Antisense; AGATCGTCGGTGAGTACGCCGTTGT
>probe:Drosophila_2:1625631_at:107:557; Interrogation_Position=650; Antisense; GGACGACTGTTGACGATGCTGGCAA

Paste this into a BLAST search page for me
ATGAGGATAAGTTTCGCCGTGCGAAAAAACCGCTACCTGATCGAGATTTGTCCTTGCGGAATGCCTGGCGTTTAATAATTGAGCCATTTCAGCGCCGATTTTAACCTGAGTAAGCTGCACGGGCAGCTGATGTCAAAGCTGGTCCAAACATGGATTGCAATCTAGCTTTCCGCTTGCCTTGGATGAGAATCTTCCCACACGAATGGCATCGATCCGGATTATATGATTATATGAGGATGCTGGCCACCGCAAGAGTTATATCCTTGCGTCTTCCGTTCACTAAGCAATGGTCTGGCCCGTAGATCGTCGGTGAGTACGCCGTTGTGGACGACTGTTGACGATGCTGGCAA

Full Affymetrix probeset data:

Annotations for 1625631_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime