FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625632_at:

>probe:Drosophila_2:1625632_at:680:371; Interrogation_Position=188; Antisense; GAAGGTATTCCGGTCAAATCCACGC
>probe:Drosophila_2:1625632_at:527:585; Interrogation_Position=213; Antisense; TGGACAACACTACCACCGTTCAGTA
>probe:Drosophila_2:1625632_at:370:473; Interrogation_Position=230; Antisense; GTTCAGTACGCTGGCCTAATGAGTC
>probe:Drosophila_2:1625632_at:541:591; Interrogation_Position=282; Antisense; TGAGGGACTTGGATCCTTCCAACGA
>probe:Drosophila_2:1625632_at:80:721; Interrogation_Position=298; Antisense; TTCCAACGACATGACATTCCTGCGG
>probe:Drosophila_2:1625632_at:166:9; Interrogation_Position=313; Antisense; ATTCCTGCGGGTGCGATCCAAGAAG
>probe:Drosophila_2:1625632_at:358:209; Interrogation_Position=335; Antisense; AAGCACGAGATCATGGTGGCACCCG
>probe:Drosophila_2:1625632_at:176:591; Interrogation_Position=348; Antisense; TGGTGGCACCCGACAAGGACTTCAT
>probe:Drosophila_2:1625632_at:662:73; Interrogation_Position=363; Antisense; AGGACTTCATCCTGATTGTCATCCA
>probe:Drosophila_2:1625632_at:38:605; Interrogation_Position=375; Antisense; TGATTGTCATCCAAAACCCAACCGA
>probe:Drosophila_2:1625632_at:92:229; Interrogation_Position=403; Antisense; AATGGCATGGTGCATCGCGACTATT
>probe:Drosophila_2:1625632_at:490:625; Interrogation_Position=417; Antisense; TCGCGACTATTGCTGAATTATCTGC
>probe:Drosophila_2:1625632_at:374:687; Interrogation_Position=47; Antisense; TATTTCATTGAACTGCAGGTAGCGG
>probe:Drosophila_2:1625632_at:469:113; Interrogation_Position=67; Antisense; AGCGGTAGTGTCTGCCGTGTTTCCA

Paste this into a BLAST search page for me
GAAGGTATTCCGGTCAAATCCACGCTGGACAACACTACCACCGTTCAGTAGTTCAGTACGCTGGCCTAATGAGTCTGAGGGACTTGGATCCTTCCAACGATTCCAACGACATGACATTCCTGCGGATTCCTGCGGGTGCGATCCAAGAAGAAGCACGAGATCATGGTGGCACCCGTGGTGGCACCCGACAAGGACTTCATAGGACTTCATCCTGATTGTCATCCATGATTGTCATCCAAAACCCAACCGAAATGGCATGGTGCATCGCGACTATTTCGCGACTATTGCTGAATTATCTGCTATTTCATTGAACTGCAGGTAGCGGAGCGGTAGTGTCTGCCGTGTTTCCA

Full Affymetrix probeset data:

Annotations for 1625632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720