Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625634_at:

>probe:Drosophila_2:1625634_at:443:361; Interrogation_Position=1102; Antisense; GCAAGGGCATGTCCATCTCCATATT
>probe:Drosophila_2:1625634_at:430:687; Interrogation_Position=1123; Antisense; TATTCCGCTTTCCACGCGATCTAGA
>probe:Drosophila_2:1625634_at:531:451; Interrogation_Position=1140; Antisense; GATCTAGAGCTTTTGGCCGCCATTG
>probe:Drosophila_2:1625634_at:457:551; Interrogation_Position=1169; Antisense; GGAGATCAACACCAAACTTACAGAG
>probe:Drosophila_2:1625634_at:326:179; Interrogation_Position=1182; Antisense; AAACTTACAGAGCATCCCATCGATC
>probe:Drosophila_2:1625634_at:10:47; Interrogation_Position=1195; Antisense; ATCCCATCGATCAGCGCATGGTGGA
>probe:Drosophila_2:1625634_at:418:683; Interrogation_Position=1229; Antisense; TATGCAAGTAAATGTCACGCGCCGT
>probe:Drosophila_2:1625634_at:55:651; Interrogation_Position=1243; Antisense; TCACGCGCCGTGAATCAGAGATGCA
>probe:Drosophila_2:1625634_at:426:661; Interrogation_Position=1277; Antisense; TAACGATTTCGACGAGCGAGCGCAA
>probe:Drosophila_2:1625634_at:723:181; Interrogation_Position=1409; Antisense; AAAACTGCAGCACGCAGAGCCGGCA
>probe:Drosophila_2:1625634_at:262:83; Interrogation_Position=1444; Antisense; AGGGCAAAGCTCTCCTACAGGACGA
>probe:Drosophila_2:1625634_at:13:557; Interrogation_Position=1463; Antisense; GGACGAGCGTTTTAAATCTGTAGAC
>probe:Drosophila_2:1625634_at:43:297; Interrogation_Position=1518; Antisense; CGAAGTAGAGCCACCCAAGAAGATA
>probe:Drosophila_2:1625634_at:521:107; Interrogation_Position=1535; Antisense; AGAAGATACCCCAACCAAGCCACTG

Paste this into a BLAST search page for me
GCAAGGGCATGTCCATCTCCATATTTATTCCGCTTTCCACGCGATCTAGAGATCTAGAGCTTTTGGCCGCCATTGGGAGATCAACACCAAACTTACAGAGAAACTTACAGAGCATCCCATCGATCATCCCATCGATCAGCGCATGGTGGATATGCAAGTAAATGTCACGCGCCGTTCACGCGCCGTGAATCAGAGATGCATAACGATTTCGACGAGCGAGCGCAAAAAACTGCAGCACGCAGAGCCGGCAAGGGCAAAGCTCTCCTACAGGACGAGGACGAGCGTTTTAAATCTGTAGACCGAAGTAGAGCCACCCAAGAAGATAAGAAGATACCCCAACCAAGCCACTG

Full Affymetrix probeset data:

Annotations for 1625634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime