Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625635_at:

>probe:Drosophila_2:1625635_at:145:563; Interrogation_Position=1597; Antisense; GGAACCGTAGCTGTGATTTCTGGAT
>probe:Drosophila_2:1625635_at:72:241; Interrogation_Position=1627; Antisense; AATAGACGTGGTGGGCACTTCTTCC
>probe:Drosophila_2:1625635_at:250:561; Interrogation_Position=1658; Antisense; GGAACATTCGATGGCCTTGGAGCGC
>probe:Drosophila_2:1625635_at:156:655; Interrogation_Position=1690; Antisense; TAAGACAATGGGATCCTCACTGGAT
>probe:Drosophila_2:1625635_at:660:545; Interrogation_Position=1711; Antisense; GGATCGATGAGTCATGACCCCATGG
>probe:Drosophila_2:1625635_at:668:161; Interrogation_Position=1784; Antisense; ACAATGCTCCATTAGAACGCCGATA
>probe:Drosophila_2:1625635_at:433:159; Interrogation_Position=1816; Antisense; ACAAACGTGTGTGGGTCGTGTCGCT
>probe:Drosophila_2:1625635_at:118:595; Interrogation_Position=1847; Antisense; TGGGCCTTTGGCTGTAGTACGTCAA
>probe:Drosophila_2:1625635_at:266:47; Interrogation_Position=1942; Antisense; ATCCGCGATTCAATTCGATCCAAGC
>probe:Drosophila_2:1625635_at:348:247; Interrogation_Position=1997; Antisense; AATTGCTGCTCTATTGGAACTGAAC
>probe:Drosophila_2:1625635_at:632:191; Interrogation_Position=2019; Antisense; AACTTTGTTGCTTTGTTGGCCGATG
>probe:Drosophila_2:1625635_at:623:729; Interrogation_Position=2034; Antisense; TTGGCCGATGATGTCTGTGTTAGCA
>probe:Drosophila_2:1625635_at:314:221; Interrogation_Position=2069; Antisense; AAGTGACCGCGTCCAGTTGATTACA
>probe:Drosophila_2:1625635_at:328:385; Interrogation_Position=2128; Antisense; GAACTAATGTATCTTGCAGGACTCT

Paste this into a BLAST search page for me
GGAACCGTAGCTGTGATTTCTGGATAATAGACGTGGTGGGCACTTCTTCCGGAACATTCGATGGCCTTGGAGCGCTAAGACAATGGGATCCTCACTGGATGGATCGATGAGTCATGACCCCATGGACAATGCTCCATTAGAACGCCGATAACAAACGTGTGTGGGTCGTGTCGCTTGGGCCTTTGGCTGTAGTACGTCAAATCCGCGATTCAATTCGATCCAAGCAATTGCTGCTCTATTGGAACTGAACAACTTTGTTGCTTTGTTGGCCGATGTTGGCCGATGATGTCTGTGTTAGCAAAGTGACCGCGTCCAGTTGATTACAGAACTAATGTATCTTGCAGGACTCT

Full Affymetrix probeset data:

Annotations for 1625635_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime