FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625637_at:

>probe:Drosophila_2:1625637_at:496:137; Interrogation_Position=1740; Antisense; ACGAGTTCGAGGATGCTAAGGACAA
>probe:Drosophila_2:1625637_at:394:391; Interrogation_Position=1792; Antisense; GAAACCAAATGTACCCAGCGTGGGA
>probe:Drosophila_2:1625637_at:340:251; Interrogation_Position=1822; Antisense; CAAGGACAGGGTTTGGGTCACTTCG
>probe:Drosophila_2:1625637_at:545:495; Interrogation_Position=1838; Antisense; GTCACTTCGGCGGTTAGTGTGCAAT
>probe:Drosophila_2:1625637_at:285:679; Interrogation_Position=1852; Antisense; TAGTGTGCAATATGCTGCCGTTCCA
>probe:Drosophila_2:1625637_at:122:267; Interrogation_Position=1912; Antisense; CAGTGGGTTTGCGTTTCGTGAAATC
>probe:Drosophila_2:1625637_at:233:161; Interrogation_Position=1943; Antisense; AAATCGGATAGCTGCATTGTGGAGT
>probe:Drosophila_2:1625637_at:398:81; Interrogation_Position=1965; Antisense; AGTGGGTGCTTTGCCTAGACCTAAA
>probe:Drosophila_2:1625637_at:678:169; Interrogation_Position=1988; Antisense; AAAGGCTATATTCCTCGCTATGTCC
>probe:Drosophila_2:1625637_at:267:637; Interrogation_Position=2030; Antisense; TCGTCCATGACCGACTACATTAGCA
>probe:Drosophila_2:1625637_at:99:643; Interrogation_Position=2056; Antisense; TCTGCGCAAGCATGTCAACGAACTG
>probe:Drosophila_2:1625637_at:50:237; Interrogation_Position=2147; Antisense; AATCCCATTGTATCTCAAGCGAGTG
>probe:Drosophila_2:1625637_at:14:335; Interrogation_Position=2171; Antisense; GCTGTTCGCAGCAAGGTATCTAATA
>probe:Drosophila_2:1625637_at:63:473; Interrogation_Position=2277; Antisense; GTTCTATGTACCTATATGCACGGCT

Paste this into a BLAST search page for me
ACGAGTTCGAGGATGCTAAGGACAAGAAACCAAATGTACCCAGCGTGGGACAAGGACAGGGTTTGGGTCACTTCGGTCACTTCGGCGGTTAGTGTGCAATTAGTGTGCAATATGCTGCCGTTCCACAGTGGGTTTGCGTTTCGTGAAATCAAATCGGATAGCTGCATTGTGGAGTAGTGGGTGCTTTGCCTAGACCTAAAAAAGGCTATATTCCTCGCTATGTCCTCGTCCATGACCGACTACATTAGCATCTGCGCAAGCATGTCAACGAACTGAATCCCATTGTATCTCAAGCGAGTGGCTGTTCGCAGCAAGGTATCTAATAGTTCTATGTACCTATATGCACGGCT

Full Affymetrix probeset data:

Annotations for 1625637_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720