FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625639_at:

>probe:Drosophila_2:1625639_at:532:45; Interrogation_Position=108; Antisense; ATCGCCAATCGTGCTGGATCGCTAT
>probe:Drosophila_2:1625639_at:680:667; Interrogation_Position=139; Antisense; TACTCCCCGTTCTATGGCGTGATGG
>probe:Drosophila_2:1625639_at:528:573; Interrogation_Position=163; Antisense; GGCGTCGTATTCTCCAGTGTGCTGA
>probe:Drosophila_2:1625639_at:467:229; Interrogation_Position=18; Antisense; AATGGATTACTATCTGCCAGTGTAT
>probe:Drosophila_2:1625639_at:683:561; Interrogation_Position=208; Antisense; GGAACTGCTGTTTCCGGAACTGGAA
>probe:Drosophila_2:1625639_at:301:605; Interrogation_Position=248; Antisense; TGATGCGTCCCGAGCTGGTGATGAA
>probe:Drosophila_2:1625639_at:206:445; Interrogation_Position=267; Antisense; GATGAAGTCCATCATTCCGGTGGTC
>probe:Drosophila_2:1625639_at:361:685; Interrogation_Position=311; Antisense; TATACGGTCTGGTGGTATCCGTGCT
>probe:Drosophila_2:1625639_at:388:403; Interrogation_Position=404; Antisense; GACTTTCGGTGGGATTTGCTGGACT
>probe:Drosophila_2:1625639_at:215:305; Interrogation_Position=495; Antisense; CCTCTTTATCGGCATGATCCTGATC
>probe:Drosophila_2:1625639_at:400:605; Interrogation_Position=515; Antisense; TGATCCTTATTTTCGCCGAGGTGCT
>probe:Drosophila_2:1625639_at:181:671; Interrogation_Position=547; Antisense; TACGGCCTGATCATTGGGATTTATT
>probe:Drosophila_2:1625639_at:81:531; Interrogation_Position=562; Antisense; GGGATTTATTTGTACACGGTCAACA
>probe:Drosophila_2:1625639_at:170:561; Interrogation_Position=96; Antisense; GGAAACCAGTATATCGCCAATCGTG

Paste this into a BLAST search page for me
ATCGCCAATCGTGCTGGATCGCTATTACTCCCCGTTCTATGGCGTGATGGGGCGTCGTATTCTCCAGTGTGCTGAAATGGATTACTATCTGCCAGTGTATGGAACTGCTGTTTCCGGAACTGGAATGATGCGTCCCGAGCTGGTGATGAAGATGAAGTCCATCATTCCGGTGGTCTATACGGTCTGGTGGTATCCGTGCTGACTTTCGGTGGGATTTGCTGGACTCCTCTTTATCGGCATGATCCTGATCTGATCCTTATTTTCGCCGAGGTGCTTACGGCCTGATCATTGGGATTTATTGGGATTTATTTGTACACGGTCAACAGGAAACCAGTATATCGCCAATCGTG

Full Affymetrix probeset data:

Annotations for 1625639_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720