Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625641_s_at:

>probe:Drosophila_2:1625641_s_at:651:157; Interrogation_Position=100; Antisense; ACACAGGACATCCTCACGTGCGGCG
>probe:Drosophila_2:1625641_s_at:150:75; Interrogation_Position=104; Antisense; AGGACATCCTCACGTGCGGCGCCTG
>probe:Drosophila_2:1625641_s_at:507:137; Interrogation_Position=115; Antisense; ACGTGCGGCGCCTGCCAGAAGGCGT
>probe:Drosophila_2:1625641_s_at:44:313; Interrogation_Position=128; Antisense; GCCAGAAGGCGTTCGCCCTCTCGGA
>probe:Drosophila_2:1625641_s_at:469:717; Interrogation_Position=139; Antisense; TTCGCCCTCTCGGACATTGTTAAGT
>probe:Drosophila_2:1625641_s_at:122:635; Interrogation_Position=140; Antisense; TCGCCCTCTCGGACATTGTTAAGTT
>probe:Drosophila_2:1625641_s_at:339:319; Interrogation_Position=142; Antisense; GCCCTCTCGGACATTGTTAAGTTCA
>probe:Drosophila_2:1625641_s_at:134:307; Interrogation_Position=144; Antisense; CCTCTCGGACATTGTTAAGTTCATC
>probe:Drosophila_2:1625641_s_at:500:639; Interrogation_Position=148; Antisense; TCGGACATTGTTAAGTTCATCCAGC
>probe:Drosophila_2:1625641_s_at:507:401; Interrogation_Position=151; Antisense; GACATTGTTAAGTTCATCCAGCACA
>probe:Drosophila_2:1625641_s_at:600:601; Interrogation_Position=156; Antisense; TGTTAAGTTCATCCAGCACAAGGTG
>probe:Drosophila_2:1625641_s_at:244:9; Interrogation_Position=68; Antisense; ATTCCGACTCCACAGAGAACGATGC
>probe:Drosophila_2:1625641_s_at:727:719; Interrogation_Position=69; Antisense; TTCCGACTCCACAGAGAACGATGCC
>probe:Drosophila_2:1625641_s_at:275:581; Interrogation_Position=95; Antisense; TGGCCACACAGGACATCCTCACGTG

Paste this into a BLAST search page for me
ACACAGGACATCCTCACGTGCGGCGAGGACATCCTCACGTGCGGCGCCTGACGTGCGGCGCCTGCCAGAAGGCGTGCCAGAAGGCGTTCGCCCTCTCGGATTCGCCCTCTCGGACATTGTTAAGTTCGCCCTCTCGGACATTGTTAAGTTGCCCTCTCGGACATTGTTAAGTTCACCTCTCGGACATTGTTAAGTTCATCTCGGACATTGTTAAGTTCATCCAGCGACATTGTTAAGTTCATCCAGCACATGTTAAGTTCATCCAGCACAAGGTGATTCCGACTCCACAGAGAACGATGCTTCCGACTCCACAGAGAACGATGCCTGGCCACACAGGACATCCTCACGTG

Full Affymetrix probeset data:

Annotations for 1625641_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime