FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625642_at:

>probe:Drosophila_2:1625642_at:561:65; Interrogation_Position=225; Antisense; ATGGACGTGGATTCTGGTGTTCCAA
>probe:Drosophila_2:1625642_at:12:533; Interrogation_Position=240; Antisense; GGTGTTCCAAGATGTTCCATTCGGC
>probe:Drosophila_2:1625642_at:217:99; Interrogation_Position=249; Antisense; AGATGTTCCATTCGGCTCCTTTCTA
>probe:Drosophila_2:1625642_at:476:697; Interrogation_Position=268; Antisense; TTTCTACGCTCAGGATCAAGGACAA
>probe:Drosophila_2:1625642_at:206:465; Interrogation_Position=319; Antisense; GTTGGAAACACTCACTCGTACACAA
>probe:Drosophila_2:1625642_at:486:145; Interrogation_Position=332; Antisense; ACTCGTACACAAACGCTTGCATACT
>probe:Drosophila_2:1625642_at:534:127; Interrogation_Position=417; Antisense; AGCCACAGCCACACCGATCGAAGAT
>probe:Drosophila_2:1625642_at:685:397; Interrogation_Position=499; Antisense; GACAGAAGTTTCCTTTGGCGACAAT
>probe:Drosophila_2:1625642_at:707:475; Interrogation_Position=532; Antisense; GTTTTTCCCATAAGCTCGAACTTGA
>probe:Drosophila_2:1625642_at:520:211; Interrogation_Position=587; Antisense; AAGTTTTCCACTCTAGCCTAGTAAG
>probe:Drosophila_2:1625642_at:720:105; Interrogation_Position=610; Antisense; AGAAATGTACATTTTTGTCTCCTGT
>probe:Drosophila_2:1625642_at:73:693; Interrogation_Position=623; Antisense; TTTGTCTCCTGTACGTTCACTTGTA
>probe:Drosophila_2:1625642_at:330:505; Interrogation_Position=663; Antisense; GTGCCAGCACTAGAACTAACCCAAG
>probe:Drosophila_2:1625642_at:556:675; Interrogation_Position=673; Antisense; TAGAACTAACCCAAGCGGCAAGCCA

Paste this into a BLAST search page for me
ATGGACGTGGATTCTGGTGTTCCAAGGTGTTCCAAGATGTTCCATTCGGCAGATGTTCCATTCGGCTCCTTTCTATTTCTACGCTCAGGATCAAGGACAAGTTGGAAACACTCACTCGTACACAAACTCGTACACAAACGCTTGCATACTAGCCACAGCCACACCGATCGAAGATGACAGAAGTTTCCTTTGGCGACAATGTTTTTCCCATAAGCTCGAACTTGAAAGTTTTCCACTCTAGCCTAGTAAGAGAAATGTACATTTTTGTCTCCTGTTTTGTCTCCTGTACGTTCACTTGTAGTGCCAGCACTAGAACTAACCCAAGTAGAACTAACCCAAGCGGCAAGCCA

Full Affymetrix probeset data:

Annotations for 1625642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720