FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625644_at:

>probe:Drosophila_2:1625644_at:294:97; Interrogation_Position=1002; Antisense; AGATCTGCCTCCCAGTTATGACAAG
>probe:Drosophila_2:1625644_at:244:201; Interrogation_Position=1037; Antisense; CAACCTTCGAGGAGGCCACAAACTT
>probe:Drosophila_2:1625644_at:345:533; Interrogation_Position=1063; Antisense; GGTGAAAGGTTCATCGACATCGATC
>probe:Drosophila_2:1625644_at:187:421; Interrogation_Position=1093; Antisense; GAGCACAATCGCACGGATGACTTTA
>probe:Drosophila_2:1625644_at:605:443; Interrogation_Position=1108; Antisense; GATGACTTTATTCCGCGTTACCCCA
>probe:Drosophila_2:1625644_at:52:375; Interrogation_Position=1177; Antisense; GAAGAGTTCGCTACCAATCAACCAG
>probe:Drosophila_2:1625644_at:359:283; Interrogation_Position=1232; Antisense; CTGCCCCATTGGTCGGTCAAAACAA
>probe:Drosophila_2:1625644_at:137:27; Interrogation_Position=1256; Antisense; ATACTGACCGTCCAACACAATCGTA
>probe:Drosophila_2:1625644_at:153:633; Interrogation_Position=1276; Antisense; TCGTACGGTTGGAACACTAACTCAT
>probe:Drosophila_2:1625644_at:49:371; Interrogation_Position=817; Antisense; GAAGGCATCATTTCGGTTAGTTACC
>probe:Drosophila_2:1625644_at:495:473; Interrogation_Position=836; Antisense; GTTACCAAGTTATCCTCACGATCAG
>probe:Drosophila_2:1625644_at:495:405; Interrogation_Position=868; Antisense; GACTGCCACGTGGACTCGGACTTTG
>probe:Drosophila_2:1625644_at:363:27; Interrogation_Position=916; Antisense; ATACCATTGATCCAAAGTGCCGAGA
>probe:Drosophila_2:1625644_at:157:423; Interrogation_Position=937; Antisense; GAGAATCCAGCCAGTGCAGCACAGT

Paste this into a BLAST search page for me
AGATCTGCCTCCCAGTTATGACAAGCAACCTTCGAGGAGGCCACAAACTTGGTGAAAGGTTCATCGACATCGATCGAGCACAATCGCACGGATGACTTTAGATGACTTTATTCCGCGTTACCCCAGAAGAGTTCGCTACCAATCAACCAGCTGCCCCATTGGTCGGTCAAAACAAATACTGACCGTCCAACACAATCGTATCGTACGGTTGGAACACTAACTCATGAAGGCATCATTTCGGTTAGTTACCGTTACCAAGTTATCCTCACGATCAGGACTGCCACGTGGACTCGGACTTTGATACCATTGATCCAAAGTGCCGAGAGAGAATCCAGCCAGTGCAGCACAGT

Full Affymetrix probeset data:

Annotations for 1625644_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720