FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625645_at:

>probe:Drosophila_2:1625645_at:38:231; Interrogation_Position=121; Antisense; AATGTGGCCCTGTTATTTCTCAAAA
>probe:Drosophila_2:1625645_at:548:271; Interrogation_Position=166; Antisense; CATATAAACCTGATTTGCCTGCCGC
>probe:Drosophila_2:1625645_at:458:309; Interrogation_Position=190; Antisense; CCACCGAATCGCAACTTTATCTATA
>probe:Drosophila_2:1625645_at:223:681; Interrogation_Position=211; Antisense; TATAATCGTTGCATTGTCAGTGGCT
>probe:Drosophila_2:1625645_at:12:185; Interrogation_Position=274; Antisense; AAAATGTGCCCCTGGTGGACAGATC
>probe:Drosophila_2:1625645_at:661:399; Interrogation_Position=291; Antisense; GACAGATCTAGGTGCCAGAGCGACA
>probe:Drosophila_2:1625645_at:116:585; Interrogation_Position=331; Antisense; TGGCAAAAACTTCTATCTCGACCCC
>probe:Drosophila_2:1625645_at:612:411; Interrogation_Position=350; Antisense; GACCCCAGTCTGATCAGGTGGGCAT
>probe:Drosophila_2:1625645_at:634:79; Interrogation_Position=365; Antisense; AGGTGGGCATCGTCAACTATGGATT
>probe:Drosophila_2:1625645_at:229:485; Interrogation_Position=391; Antisense; GTATGTGGCACAGATATTCCTGCTG
>probe:Drosophila_2:1625645_at:254:459; Interrogation_Position=403; Antisense; GATATTCCTGCTGTTTACACTGATG
>probe:Drosophila_2:1625645_at:75:387; Interrogation_Position=432; Antisense; GAAAATGCGACCCTGTACTGACTAT
>probe:Drosophila_2:1625645_at:325:97; Interrogation_Position=458; Antisense; AGATCAAATGCTTACCAACCACAAA
>probe:Drosophila_2:1625645_at:25:687; Interrogation_Position=587; Antisense; TATAATCCCAATATCAACCAACGTG

Paste this into a BLAST search page for me
AATGTGGCCCTGTTATTTCTCAAAACATATAAACCTGATTTGCCTGCCGCCCACCGAATCGCAACTTTATCTATATATAATCGTTGCATTGTCAGTGGCTAAAATGTGCCCCTGGTGGACAGATCGACAGATCTAGGTGCCAGAGCGACATGGCAAAAACTTCTATCTCGACCCCGACCCCAGTCTGATCAGGTGGGCATAGGTGGGCATCGTCAACTATGGATTGTATGTGGCACAGATATTCCTGCTGGATATTCCTGCTGTTTACACTGATGGAAAATGCGACCCTGTACTGACTATAGATCAAATGCTTACCAACCACAAATATAATCCCAATATCAACCAACGTG

Full Affymetrix probeset data:

Annotations for 1625645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720