Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625646_at:

>probe:Drosophila_2:1625646_at:501:175; Interrogation_Position=4387; Antisense; AAACGAGTTCACTAGCTGGTGCATA
>probe:Drosophila_2:1625646_at:614:415; Interrogation_Position=4414; Antisense; GAGCCTAGATAATATGTCCGCCAAA
>probe:Drosophila_2:1625646_at:655:171; Interrogation_Position=4436; Antisense; AAAGTTGATGTACCCACGTTCGTTG
>probe:Drosophila_2:1625646_at:195:309; Interrogation_Position=4449; Antisense; CCACGTTCGTTGCATTCTTGCAGGA
>probe:Drosophila_2:1625646_at:573:711; Interrogation_Position=4463; Antisense; TTCTTGCAGGACTTGGAAGCGCCAT
>probe:Drosophila_2:1625646_at:393:557; Interrogation_Position=4498; Antisense; GGACTATGTCCGAATATACCTTGAG
>probe:Drosophila_2:1625646_at:178:207; Interrogation_Position=4565; Antisense; AAGCAGTTTTTGGAGCGACGTAGCA
>probe:Drosophila_2:1625646_at:233:1; Interrogation_Position=4597; Antisense; AAGCTTGCAACGTGCCCAAAAGGCA
>probe:Drosophila_2:1625646_at:118:409; Interrogation_Position=4628; Antisense; GACGATATGTGCAAACCAGCTCCTG
>probe:Drosophila_2:1625646_at:159:673; Interrogation_Position=4657; Antisense; TACGCCATCTGCGAATGACTATGCC
>probe:Drosophila_2:1625646_at:307:659; Interrogation_Position=4717; Antisense; TAAGATGACTAAGATGGACGCCCGC
>probe:Drosophila_2:1625646_at:347:319; Interrogation_Position=4736; Antisense; GCCCGCATTCTTGGGTTTTCAGTAA
>probe:Drosophila_2:1625646_at:721:659; Interrogation_Position=4758; Antisense; TAACTGCTGCCGAGGGTCGCATAAA
>probe:Drosophila_2:1625646_at:321:167; Interrogation_Position=4780; Antisense; AAATGTTGGCATTCGAGACTACGTC

Paste this into a BLAST search page for me
AAACGAGTTCACTAGCTGGTGCATAGAGCCTAGATAATATGTCCGCCAAAAAAGTTGATGTACCCACGTTCGTTGCCACGTTCGTTGCATTCTTGCAGGATTCTTGCAGGACTTGGAAGCGCCATGGACTATGTCCGAATATACCTTGAGAAGCAGTTTTTGGAGCGACGTAGCAAAGCTTGCAACGTGCCCAAAAGGCAGACGATATGTGCAAACCAGCTCCTGTACGCCATCTGCGAATGACTATGCCTAAGATGACTAAGATGGACGCCCGCGCCCGCATTCTTGGGTTTTCAGTAATAACTGCTGCCGAGGGTCGCATAAAAAATGTTGGCATTCGAGACTACGTC

Full Affymetrix probeset data:

Annotations for 1625646_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime