FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625648_at:

>probe:Drosophila_2:1625648_at:107:23; Interrogation_Position=1010; Antisense; ATATCTCTGTGGCTGGCGATGCCAA
>probe:Drosophila_2:1625648_at:265:215; Interrogation_Position=1045; Antisense; AAGATGACTCTTGCTGCCCTTTTGG
>probe:Drosophila_2:1625648_at:622:129; Interrogation_Position=1078; Antisense; CACTAAATAACTCTGCCCCGATTAA
>probe:Drosophila_2:1625648_at:333:531; Interrogation_Position=595; Antisense; GGTGACAAAGCTCTCCCAAAAATGA
>probe:Drosophila_2:1625648_at:634:587; Interrogation_Position=644; Antisense; TGGAGATTAAGACCCATGCCGACGC
>probe:Drosophila_2:1625648_at:421:453; Interrogation_Position=670; Antisense; GATCAAATTCCCGACATGTCCGTTG
>probe:Drosophila_2:1625648_at:666:303; Interrogation_Position=698; Antisense; CCGATGCTGATGATACCCCAAGGAA
>probe:Drosophila_2:1625648_at:61:373; Interrogation_Position=720; Antisense; GAAGGTTGCAGCTAGCCTCAAGACC
>probe:Drosophila_2:1625648_at:95:589; Interrogation_Position=782; Antisense; TGGAGATCATGACCCATGCCGATGA
>probe:Drosophila_2:1625648_at:686:443; Interrogation_Position=802; Antisense; GATGACGGTCTTATTCCCGACATGT
>probe:Drosophila_2:1625648_at:570:207; Interrogation_Position=856; Antisense; AAGCAGACTGTTGCCGGTCTCAAGG
>probe:Drosophila_2:1625648_at:477:467; Interrogation_Position=891; Antisense; GTTGACCAAGGTTTCCGGAGCCAAT
>probe:Drosophila_2:1625648_at:646:553; Interrogation_Position=907; Antisense; GGAGCCAATCCCGTAGAGCCGATTT
>probe:Drosophila_2:1625648_at:655:207; Interrogation_Position=935; Antisense; AAGCTAATGCTGATCTGGTTCCCGA

Paste this into a BLAST search page for me
ATATCTCTGTGGCTGGCGATGCCAAAAGATGACTCTTGCTGCCCTTTTGGCACTAAATAACTCTGCCCCGATTAAGGTGACAAAGCTCTCCCAAAAATGATGGAGATTAAGACCCATGCCGACGCGATCAAATTCCCGACATGTCCGTTGCCGATGCTGATGATACCCCAAGGAAGAAGGTTGCAGCTAGCCTCAAGACCTGGAGATCATGACCCATGCCGATGAGATGACGGTCTTATTCCCGACATGTAAGCAGACTGTTGCCGGTCTCAAGGGTTGACCAAGGTTTCCGGAGCCAATGGAGCCAATCCCGTAGAGCCGATTTAAGCTAATGCTGATCTGGTTCCCGA

Full Affymetrix probeset data:

Annotations for 1625648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720