Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625650_at:

>probe:Drosophila_2:1625650_at:455:185; Interrogation_Position=357; Antisense; AAAATTCTTCCAATTCCAGCAGCAC
>probe:Drosophila_2:1625650_at:528:159; Interrogation_Position=380; Antisense; ACAACTGAGTGCGTCTGTGCCGGTG
>probe:Drosophila_2:1625650_at:239:225; Interrogation_Position=434; Antisense; AAGGAGCTGCCCATATGCGCCGAGT
>probe:Drosophila_2:1625650_at:535:361; Interrogation_Position=459; Antisense; GCAAGTGCTCCCATGTGGCGAGAAA
>probe:Drosophila_2:1625650_at:143:23; Interrogation_Position=542; Antisense; ATATACATGCTCTTCCTGATGTGCC
>probe:Drosophila_2:1625650_at:283:607; Interrogation_Position=558; Antisense; TGATGTGCCTGGACCCGTTGCTGAA
>probe:Drosophila_2:1625650_at:243:71; Interrogation_Position=594; Antisense; AGGCGAACTACCAGGAGCACACCAA
>probe:Drosophila_2:1625650_at:204:495; Interrogation_Position=653; Antisense; GTCAACAACCAGGAGCTCAGTGCCA
>probe:Drosophila_2:1625650_at:457:415; Interrogation_Position=678; Antisense; GAGCCAATGTCCTCAATCGTGTGGG
>probe:Drosophila_2:1625650_at:247:425; Interrogation_Position=742; Antisense; GAGACGCCACATCTACGACAGGCAT
>probe:Drosophila_2:1625650_at:230:577; Interrogation_Position=817; Antisense; GGCGCATGGGCGACTTAAGACACGT
>probe:Drosophila_2:1625650_at:431:397; Interrogation_Position=835; Antisense; GACACGTATTCCAAGCAGTTATCCT
>probe:Drosophila_2:1625650_at:134:1; Interrogation_Position=850; Antisense; CAGTTATCCTTTGCGAAATTCCCCT
>probe:Drosophila_2:1625650_at:463:323; Interrogation_Position=862; Antisense; GCGAAATTCCCCTTTGGATCAAATT

Paste this into a BLAST search page for me
AAAATTCTTCCAATTCCAGCAGCACACAACTGAGTGCGTCTGTGCCGGTGAAGGAGCTGCCCATATGCGCCGAGTGCAAGTGCTCCCATGTGGCGAGAAAATATACATGCTCTTCCTGATGTGCCTGATGTGCCTGGACCCGTTGCTGAAAGGCGAACTACCAGGAGCACACCAAGTCAACAACCAGGAGCTCAGTGCCAGAGCCAATGTCCTCAATCGTGTGGGGAGACGCCACATCTACGACAGGCATGGCGCATGGGCGACTTAAGACACGTGACACGTATTCCAAGCAGTTATCCTCAGTTATCCTTTGCGAAATTCCCCTGCGAAATTCCCCTTTGGATCAAATT

Full Affymetrix probeset data:

Annotations for 1625650_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime