FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625651_at:

>probe:Drosophila_2:1625651_at:331:535; Interrogation_Position=1189; Antisense; GGTGCACTTTGTCATCTACGAGTTT
>probe:Drosophila_2:1625651_at:682:395; Interrogation_Position=1239; Antisense; GAAATCAGCGGCATACGGACACCAA
>probe:Drosophila_2:1625651_at:29:223; Interrogation_Position=1262; Antisense; AAGGGATCCCGCGACTTTCTGGAGT
>probe:Drosophila_2:1625651_at:578:605; Interrogation_Position=1290; Antisense; TGATGGCTGGCGCTGTTTCCAAAAC
>probe:Drosophila_2:1625651_at:528:565; Interrogation_Position=1373; Antisense; GGCAACAAATACAACTCCTTCTGGC
>probe:Drosophila_2:1625651_at:65:351; Interrogation_Position=1396; Antisense; GCAGACCCTGCACACTGTTTGGAAG
>probe:Drosophila_2:1625651_at:85:75; Interrogation_Position=1435; Antisense; AGGACTCTACAGAGGCTTGGCCACG
>probe:Drosophila_2:1625651_at:625:95; Interrogation_Position=1473; Antisense; AGATTCCCAACACGGCGATCATGAT
>probe:Drosophila_2:1625651_at:230:683; Interrogation_Position=1505; Antisense; TATGAGGCGGTCGTCTATGTGCTCA
>probe:Drosophila_2:1625651_at:523:135; Interrogation_Position=1529; Antisense; ACGCGGCGCTTCAACAACAAATCGA
>probe:Drosophila_2:1625651_at:135:429; Interrogation_Position=1556; Antisense; GAGTTCTACGACTTTTAGATGCCTT
>probe:Drosophila_2:1625651_at:414:549; Interrogation_Position=1597; Antisense; GGAGTAACCCAATCTGTGCATATGT
>probe:Drosophila_2:1625651_at:234:681; Interrogation_Position=1617; Antisense; TATGTAGACGCGACTGCTGCAACTT
>probe:Drosophila_2:1625651_at:234:177; Interrogation_Position=1666; Antisense; AAACGATCCAAACCAACGAGCGCAA

Paste this into a BLAST search page for me
GGTGCACTTTGTCATCTACGAGTTTGAAATCAGCGGCATACGGACACCAAAAGGGATCCCGCGACTTTCTGGAGTTGATGGCTGGCGCTGTTTCCAAAACGGCAACAAATACAACTCCTTCTGGCGCAGACCCTGCACACTGTTTGGAAGAGGACTCTACAGAGGCTTGGCCACGAGATTCCCAACACGGCGATCATGATTATGAGGCGGTCGTCTATGTGCTCAACGCGGCGCTTCAACAACAAATCGAGAGTTCTACGACTTTTAGATGCCTTGGAGTAACCCAATCTGTGCATATGTTATGTAGACGCGACTGCTGCAACTTAAACGATCCAAACCAACGAGCGCAA

Full Affymetrix probeset data:

Annotations for 1625651_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720