FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625654_at:

>probe:Drosophila_2:1625654_at:452:701; Interrogation_Position=2293; Antisense; TTTTGGCGAGAAGCACTATGGCATT
>probe:Drosophila_2:1625654_at:525:7; Interrogation_Position=2315; Antisense; ATTGCAGTGCCGTTGAACGCCGACT
>probe:Drosophila_2:1625654_at:302:715; Interrogation_Position=2340; Antisense; TTCGGTCCAATCTCAGCGTGGGAAT
>probe:Drosophila_2:1625654_at:358:57; Interrogation_Position=2424; Antisense; ATGAGAGCACCTGCGACTCGAATGT
>probe:Drosophila_2:1625654_at:535:369; Interrogation_Position=2443; Antisense; GAATGTCCCGACCATCGATGATGGC
>probe:Drosophila_2:1625654_at:578:143; Interrogation_Position=2494; Antisense; ACTGTTCGTGGTGCTGATCGTCGGC
>probe:Drosophila_2:1625654_at:579:429; Interrogation_Position=2549; Antisense; GAGTTTTTGTGGCACGTCCAGCGCA
>probe:Drosophila_2:1625654_at:244:137; Interrogation_Position=2562; Antisense; ACGTCCAGCGCATTTCGGTGAAGGA
>probe:Drosophila_2:1625654_at:540:75; Interrogation_Position=2583; Antisense; AGGAGAAGATTCCACCCATGCTGGC
>probe:Drosophila_2:1625654_at:76:723; Interrogation_Position=2645; Antisense; TTGACTAGAAAACCGCTGCACACCT
>probe:Drosophila_2:1625654_at:24:259; Interrogation_Position=2663; Antisense; CACACCTATCGCCAAAGTCGGGATT
>probe:Drosophila_2:1625654_at:11:543; Interrogation_Position=2683; Antisense; GGATTCAACTTCGACGGGTTACTCA
>probe:Drosophila_2:1625654_at:553:139; Interrogation_Position=2696; Antisense; ACGGGTTACTCATCGCTGGAGCAAA
>probe:Drosophila_2:1625654_at:301:169; Interrogation_Position=2785; Antisense; AAAGGCTTGCGAACATTCAGTGAAA

Paste this into a BLAST search page for me
TTTTGGCGAGAAGCACTATGGCATTATTGCAGTGCCGTTGAACGCCGACTTTCGGTCCAATCTCAGCGTGGGAATATGAGAGCACCTGCGACTCGAATGTGAATGTCCCGACCATCGATGATGGCACTGTTCGTGGTGCTGATCGTCGGCGAGTTTTTGTGGCACGTCCAGCGCAACGTCCAGCGCATTTCGGTGAAGGAAGGAGAAGATTCCACCCATGCTGGCTTGACTAGAAAACCGCTGCACACCTCACACCTATCGCCAAAGTCGGGATTGGATTCAACTTCGACGGGTTACTCAACGGGTTACTCATCGCTGGAGCAAAAAAGGCTTGCGAACATTCAGTGAAA

Full Affymetrix probeset data:

Annotations for 1625654_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720