FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625655_at:

>probe:Drosophila_2:1625655_at:711:605; Interrogation_Position=118; Antisense; TGATCTGAAGATCGGAACCCTGGTG
>probe:Drosophila_2:1625655_at:224:133; Interrogation_Position=134; Antisense; ACCCTGGTGGGCATCGACAAGTACG
>probe:Drosophila_2:1625655_at:299:357; Interrogation_Position=159; Antisense; GCAACAAGTACTTCGAGAACCCGTA
>probe:Drosophila_2:1625655_at:81:671; Interrogation_Position=191; Antisense; TACGGCCGCAATCGCTGGATCGAGT
>probe:Drosophila_2:1625655_at:98:215; Interrogation_Position=23; Antisense; AAGTTTTTGGGCATCAACCGGCTGA
>probe:Drosophila_2:1625655_at:310:441; Interrogation_Position=242; Antisense; GATGGATCCATGATTCCCGCCGAGT
>probe:Drosophila_2:1625655_at:269:489; Interrogation_Position=268; Antisense; GTACGGCTGGATGCACTACAAGACC
>probe:Drosophila_2:1625655_at:557:447; Interrogation_Position=315; Antisense; GATGCCGCCCCAAGTACAAGTGGAT
>probe:Drosophila_2:1625655_at:509:675; Interrogation_Position=339; Antisense; TAGCGGACCACAGCGAGAATCTTTC
>probe:Drosophila_2:1625655_at:541:201; Interrogation_Position=38; Antisense; AACCGGCTGACAAAGCTGTTCCAGA
>probe:Drosophila_2:1625655_at:607:335; Interrogation_Position=488; Antisense; GCTGCGATTGATGAGAACACCCGAT
>probe:Drosophila_2:1625655_at:387:205; Interrogation_Position=50; Antisense; AAGCTGTTCCAGATGGTCCGCGAAG
>probe:Drosophila_2:1625655_at:500:245; Interrogation_Position=528; Antisense; AATTTTGTTGACTCTGCACTCGAAG
>probe:Drosophila_2:1625655_at:8:377; Interrogation_Position=85; Antisense; GAAGCAAGCGTACCTGAAGCTCTAT

Paste this into a BLAST search page for me
TGATCTGAAGATCGGAACCCTGGTGACCCTGGTGGGCATCGACAAGTACGGCAACAAGTACTTCGAGAACCCGTATACGGCCGCAATCGCTGGATCGAGTAAGTTTTTGGGCATCAACCGGCTGAGATGGATCCATGATTCCCGCCGAGTGTACGGCTGGATGCACTACAAGACCGATGCCGCCCCAAGTACAAGTGGATTAGCGGACCACAGCGAGAATCTTTCAACCGGCTGACAAAGCTGTTCCAGAGCTGCGATTGATGAGAACACCCGATAAGCTGTTCCAGATGGTCCGCGAAGAATTTTGTTGACTCTGCACTCGAAGGAAGCAAGCGTACCTGAAGCTCTAT

Full Affymetrix probeset data:

Annotations for 1625655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720