FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625657_at:

>probe:Drosophila_2:1625657_at:324:595; Interrogation_Position=1011; Antisense; TGTGGAGTACGAGGCCTATCTGAAC
>probe:Drosophila_2:1625657_at:578:431; Interrogation_Position=1046; Antisense; GAGTGATCCGTGTGGACAGACCCGT
>probe:Drosophila_2:1625657_at:153:103; Interrogation_Position=1063; Antisense; AGACCCGTGGCGACCGATCAGTTGG
>probe:Drosophila_2:1625657_at:213:643; Interrogation_Position=1105; Antisense; TCTGCTCATTTGTTCCTGCCAAAAA
>probe:Drosophila_2:1625657_at:225:465; Interrogation_Position=574; Antisense; GATTGTGTTCTCGAAAGGATTCCCG
>probe:Drosophila_2:1625657_at:4:239; Interrogation_Position=605; Antisense; AATCTCGTGCTGCTCTGATCCTGAA
>probe:Drosophila_2:1625657_at:451:201; Interrogation_Position=650; Antisense; AACCAGGTCAAGTGCTCCGAATTTC
>probe:Drosophila_2:1625657_at:151:633; Interrogation_Position=717; Antisense; TCGCAAGGGTCTGGAACGGCACTAC
>probe:Drosophila_2:1625657_at:713:515; Interrogation_Position=791; Antisense; GTGTCCACCAGCACGTAATGCGAGA
>probe:Drosophila_2:1625657_at:680:427; Interrogation_Position=812; Antisense; GAGATTTTAGCAAGACGCCCATCCA
>probe:Drosophila_2:1625657_at:421:719; Interrogation_Position=862; Antisense; TTGAAGTTCTACGAAATGCCCGCCC
>probe:Drosophila_2:1625657_at:153:97; Interrogation_Position=887; Antisense; AGCTAAACGCAGTGGGCACCTTGGT
>probe:Drosophila_2:1625657_at:693:225; Interrogation_Position=916; Antisense; AAGGACATGGGACTGGACCTCCGCC
>probe:Drosophila_2:1625657_at:407:257; Interrogation_Position=952; Antisense; CACTCGTTTTCCTTTGCAAACTGGG

Paste this into a BLAST search page for me
TGTGGAGTACGAGGCCTATCTGAACGAGTGATCCGTGTGGACAGACCCGTAGACCCGTGGCGACCGATCAGTTGGTCTGCTCATTTGTTCCTGCCAAAAAGATTGTGTTCTCGAAAGGATTCCCGAATCTCGTGCTGCTCTGATCCTGAAAACCAGGTCAAGTGCTCCGAATTTCTCGCAAGGGTCTGGAACGGCACTACGTGTCCACCAGCACGTAATGCGAGAGAGATTTTAGCAAGACGCCCATCCATTGAAGTTCTACGAAATGCCCGCCCAGCTAAACGCAGTGGGCACCTTGGTAAGGACATGGGACTGGACCTCCGCCCACTCGTTTTCCTTTGCAAACTGGG

Full Affymetrix probeset data:

Annotations for 1625657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720