FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625658_at:

>probe:Drosophila_2:1625658_at:166:661; Interrogation_Position=1091; Antisense; TAAAGAAAAGCACCCAAATCGTAAG
>probe:Drosophila_2:1625658_at:404:693; Interrogation_Position=1171; Antisense; TTTCGAGAGCAATTGTCCAGCAAGT
>probe:Drosophila_2:1625658_at:404:135; Interrogation_Position=628; Antisense; ACGACAACGAAACCTGGCACCCGTG
>probe:Drosophila_2:1625658_at:595:525; Interrogation_Position=689; Antisense; GGGAACGGCGTTAAATGGTCTACAG
>probe:Drosophila_2:1625658_at:507:65; Interrogation_Position=703; Antisense; ATGGTCTACAGACGCGGGATAGCAC
>probe:Drosophila_2:1625658_at:42:135; Interrogation_Position=714; Antisense; ACGCGGGATAGCACTTAGCGATCAA
>probe:Drosophila_2:1625658_at:480:173; Interrogation_Position=744; Antisense; AAACCTCTACAGTAATGCATAGCTT
>probe:Drosophila_2:1625658_at:350:211; Interrogation_Position=772; Antisense; AAGACATGTTTACACATCCCAAATG
>probe:Drosophila_2:1625658_at:564:45; Interrogation_Position=787; Antisense; ATCCCAAATGATCGGACCTGGATTT
>probe:Drosophila_2:1625658_at:166:413; Interrogation_Position=801; Antisense; GACCTGGATTTGGTATGTTATCTAG
>probe:Drosophila_2:1625658_at:14:603; Interrogation_Position=816; Antisense; TGTTATCTAGACTATTTGGGCTTTA
>probe:Drosophila_2:1625658_at:247:139; Interrogation_Position=847; Antisense; ACGTAATAGGTCTGCATTTATGAGT
>probe:Drosophila_2:1625658_at:40:431; Interrogation_Position=868; Antisense; GAGTATCAGTTAACCATTCAATTAT
>probe:Drosophila_2:1625658_at:515:419; Interrogation_Position=937; Antisense; GAGCATGTTTTCGTCGAACTATTTA

Paste this into a BLAST search page for me
TAAAGAAAAGCACCCAAATCGTAAGTTTCGAGAGCAATTGTCCAGCAAGTACGACAACGAAACCTGGCACCCGTGGGGAACGGCGTTAAATGGTCTACAGATGGTCTACAGACGCGGGATAGCACACGCGGGATAGCACTTAGCGATCAAAAACCTCTACAGTAATGCATAGCTTAAGACATGTTTACACATCCCAAATGATCCCAAATGATCGGACCTGGATTTGACCTGGATTTGGTATGTTATCTAGTGTTATCTAGACTATTTGGGCTTTAACGTAATAGGTCTGCATTTATGAGTGAGTATCAGTTAACCATTCAATTATGAGCATGTTTTCGTCGAACTATTTA

Full Affymetrix probeset data:

Annotations for 1625658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720