FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625659_at:

>probe:Drosophila_2:1625659_at:709:117; Interrogation_Position=113; Antisense; AGCTGCCTAATCTGGACTTTTCGAG
>probe:Drosophila_2:1625659_at:551:429; Interrogation_Position=135; Antisense; GAGTTTCAACTCCAAGTGCAGTCAG
>probe:Drosophila_2:1625659_at:366:343; Interrogation_Position=15; Antisense; GCTTCACAAGCTGACTTGGGTTCTA
>probe:Drosophila_2:1625659_at:37:229; Interrogation_Position=169; Antisense; AATGGAGTCCACATATCACCTTGCA
>probe:Drosophila_2:1625659_at:185:727; Interrogation_Position=197; Antisense; TTGAGTGCATCTTTCGAGCGGCGAA
>probe:Drosophila_2:1625659_at:88:595; Interrogation_Position=281; Antisense; TGGGCTCTGATGAATTTGTGCACGT
>probe:Drosophila_2:1625659_at:688:691; Interrogation_Position=295; Antisense; TTTGTGCACGTGTATCTGGATGGAT
>probe:Drosophila_2:1625659_at:403:71; Interrogation_Position=356; Antisense; AGGCAATGAAACGTCGCCGTGTTCC
>probe:Drosophila_2:1625659_at:270:33; Interrogation_Position=409; Antisense; ATAATGTATGGCCTGTGTGCCCATC
>probe:Drosophila_2:1625659_at:474:17; Interrogation_Position=42; Antisense; ATTTATACCTGCTTTTCGAGCTGCC
>probe:Drosophila_2:1625659_at:204:507; Interrogation_Position=425; Antisense; GTGCCCATCGATATGTCTACCGTAA
>probe:Drosophila_2:1625659_at:225:587; Interrogation_Position=466; Antisense; TGGAGCAAGAGTGCCACCTGCAATG
>probe:Drosophila_2:1625659_at:190:45; Interrogation_Position=68; Antisense; ATCCCATTTGCTCTCAAAGGCCGGA
>probe:Drosophila_2:1625659_at:65:579; Interrogation_Position=86; Antisense; GGCCGGATGCCTTGAGAAACTGTTG

Paste this into a BLAST search page for me
AGCTGCCTAATCTGGACTTTTCGAGGAGTTTCAACTCCAAGTGCAGTCAGGCTTCACAAGCTGACTTGGGTTCTAAATGGAGTCCACATATCACCTTGCATTGAGTGCATCTTTCGAGCGGCGAATGGGCTCTGATGAATTTGTGCACGTTTTGTGCACGTGTATCTGGATGGATAGGCAATGAAACGTCGCCGTGTTCCATAATGTATGGCCTGTGTGCCCATCATTTATACCTGCTTTTCGAGCTGCCGTGCCCATCGATATGTCTACCGTAATGGAGCAAGAGTGCCACCTGCAATGATCCCATTTGCTCTCAAAGGCCGGAGGCCGGATGCCTTGAGAAACTGTTG

Full Affymetrix probeset data:

Annotations for 1625659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720