Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625660_at:

>probe:Drosophila_2:1625660_at:526:313; Interrogation_Position=164; Antisense; GCCAGAGTGTGTGCATCCGCAACAA
>probe:Drosophila_2:1625660_at:362:223; Interrogation_Position=187; Antisense; AAGGTGACCAATGTGTGCACCCGCC
>probe:Drosophila_2:1625660_at:538:363; Interrogation_Position=237; Antisense; GAATTGCCGCCGTCGGGACAATGGA
>probe:Drosophila_2:1625660_at:284:525; Interrogation_Position=251; Antisense; GGGACAATGGACTCGAACCCATTCG
>probe:Drosophila_2:1625660_at:415:201; Interrogation_Position=266; Antisense; AACCCATTCGGGAGACATGCATCAC
>probe:Drosophila_2:1625660_at:424:309; Interrogation_Position=357; Antisense; CCAGTCCGATGGCAAGCGCATCAAG
>probe:Drosophila_2:1625660_at:23:101; Interrogation_Position=389; Antisense; AGAGGAGGATCTGCCTTGACGACAA
>probe:Drosophila_2:1625660_at:288:75; Interrogation_Position=478; Antisense; AGGAGGAACTGCGTCCGGAATCCGC
>probe:Drosophila_2:1625660_at:638:307; Interrogation_Position=491; Antisense; TCCGGAATCCGCTTAACCAGTGGGT
>probe:Drosophila_2:1625660_at:564:703; Interrogation_Position=503; Antisense; TTAACCAGTGGGTGAGGGCCAGCCA
>probe:Drosophila_2:1625660_at:254:29; Interrogation_Position=626; Antisense; ATACGCGGATCCCAACTTGAATCCT
>probe:Drosophila_2:1625660_at:323:721; Interrogation_Position=642; Antisense; TTGAATCCTGGCACTGACCTCCTTT
>probe:Drosophila_2:1625660_at:517:411; Interrogation_Position=657; Antisense; GACCTCCTTTCGCATACAGTTTTTT
>probe:Drosophila_2:1625660_at:262:699; Interrogation_Position=703; Antisense; TTTTTGCCTATGTTAGTCCCGTACA

Paste this into a BLAST search page for me
GCCAGAGTGTGTGCATCCGCAACAAAAGGTGACCAATGTGTGCACCCGCCGAATTGCCGCCGTCGGGACAATGGAGGGACAATGGACTCGAACCCATTCGAACCCATTCGGGAGACATGCATCACCCAGTCCGATGGCAAGCGCATCAAGAGAGGAGGATCTGCCTTGACGACAAAGGAGGAACTGCGTCCGGAATCCGCTCCGGAATCCGCTTAACCAGTGGGTTTAACCAGTGGGTGAGGGCCAGCCAATACGCGGATCCCAACTTGAATCCTTTGAATCCTGGCACTGACCTCCTTTGACCTCCTTTCGCATACAGTTTTTTTTTTTGCCTATGTTAGTCCCGTACA

Full Affymetrix probeset data:

Annotations for 1625660_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime