FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625662_at:

>probe:Drosophila_2:1625662_at:472:3; Interrogation_Position=1053; Antisense; ATTGGCATCCACTTTTACACTGACC
>probe:Drosophila_2:1625662_at:705:609; Interrogation_Position=1073; Antisense; TGACCGCTCAGAATGTGTGCGCCAA
>probe:Drosophila_2:1625662_at:473:215; Interrogation_Position=1107; Antisense; AAGTTTCCGGATGACCAGTGATCTG
>probe:Drosophila_2:1625662_at:241:41; Interrogation_Position=1127; Antisense; ATCTGGTGTATCACATGCGATCCCA
>probe:Drosophila_2:1625662_at:406:623; Interrogation_Position=1142; Antisense; TGCGATCCCATCACAAAAGCGAAGT
>probe:Drosophila_2:1625662_at:124:207; Interrogation_Position=1158; Antisense; AAGCGAAGTGGCCTGCGATCCAAAT
>probe:Drosophila_2:1625662_at:103:77; Interrogation_Position=1196; Antisense; AGGAGAAACTCCGATGTCCCGTCTG
>probe:Drosophila_2:1625662_at:170:425; Interrogation_Position=1225; Antisense; GAGACTTTCAGGGAGCGACACCATC
>probe:Drosophila_2:1625662_at:329:643; Interrogation_Position=1321; Antisense; TCTGCCGGTGACAACGAGATCATCA
>probe:Drosophila_2:1625662_at:377:427; Interrogation_Position=1336; Antisense; GAGATCATCAACGTGGTCGGCGGCA
>probe:Drosophila_2:1625662_at:399:501; Interrogation_Position=1370; Antisense; GTCGCCGAATGGGTGGTATGCCCAA
>probe:Drosophila_2:1625662_at:642:155; Interrogation_Position=831; Antisense; ACAGCAGCGCCTTAAGCAGCAGTTG
>probe:Drosophila_2:1625662_at:437:209; Interrogation_Position=844; Antisense; AAGCAGCAGTTGTTGTACACCCGTC
>probe:Drosophila_2:1625662_at:385:437; Interrogation_Position=893; Antisense; GAGGAGGACCTACTATGCAGGCAAA

Paste this into a BLAST search page for me
ATTGGCATCCACTTTTACACTGACCTGACCGCTCAGAATGTGTGCGCCAAAAGTTTCCGGATGACCAGTGATCTGATCTGGTGTATCACATGCGATCCCATGCGATCCCATCACAAAAGCGAAGTAAGCGAAGTGGCCTGCGATCCAAATAGGAGAAACTCCGATGTCCCGTCTGGAGACTTTCAGGGAGCGACACCATCTCTGCCGGTGACAACGAGATCATCAGAGATCATCAACGTGGTCGGCGGCAGTCGCCGAATGGGTGGTATGCCCAAACAGCAGCGCCTTAAGCAGCAGTTGAAGCAGCAGTTGTTGTACACCCGTCGAGGAGGACCTACTATGCAGGCAAA

Full Affymetrix probeset data:

Annotations for 1625662_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720