FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625664_at:

>probe:Drosophila_2:1625664_at:224:657; Interrogation_Position=102; Antisense; TAATCCAGATGTGTCCAGAGCGGCG
>probe:Drosophila_2:1625664_at:637:101; Interrogation_Position=118; Antisense; AGAGCGGCGATCCAGATTCACATTG
>probe:Drosophila_2:1625664_at:63:87; Interrogation_Position=162; Antisense; AGTGCAGCCGTTGCATATGTGCCGC
>probe:Drosophila_2:1625664_at:132:63; Interrogation_Position=178; Antisense; ATGTGCCGCTGGATGCTGCTGGTCA
>probe:Drosophila_2:1625664_at:680:41; Interrogation_Position=202; Antisense; ATCGGAGTCTGTTGCCTGATGGGCA
>probe:Drosophila_2:1625664_at:164:155; Interrogation_Position=323; Antisense; ACAGAAGGTCCATCGAGTTCGCGCA
>probe:Drosophila_2:1625664_at:74:39; Interrogation_Position=353; Antisense; ATCTGAATCGACTTGGATCCGGCAA
>probe:Drosophila_2:1625664_at:41:551; Interrogation_Position=37; Antisense; GGAGTCGGCGACGTCATCCAGACAT
>probe:Drosophila_2:1625664_at:312:209; Interrogation_Position=388; Antisense; AAGCATCACTACATCAGCCGAAGCA
>probe:Drosophila_2:1625664_at:192:351; Interrogation_Position=410; Antisense; GCAGCTATCCAATGGGTGGCTACCT
>probe:Drosophila_2:1625664_at:335:671; Interrogation_Position=430; Antisense; TACCTGAAGGTGACCCGGGAGCACT
>probe:Drosophila_2:1625664_at:714:529; Interrogation_Position=536; Antisense; GGGATCACTCGAGCAGGTCCTACAA
>probe:Drosophila_2:1625664_at:14:161; Interrogation_Position=560; Antisense; ACAACATTCCCTACTGCTGTCTAAA
>probe:Drosophila_2:1625664_at:339:573; Interrogation_Position=80; Antisense; GGCTGTCGTCATCCGAAGTGGTTAA

Paste this into a BLAST search page for me
TAATCCAGATGTGTCCAGAGCGGCGAGAGCGGCGATCCAGATTCACATTGAGTGCAGCCGTTGCATATGTGCCGCATGTGCCGCTGGATGCTGCTGGTCAATCGGAGTCTGTTGCCTGATGGGCAACAGAAGGTCCATCGAGTTCGCGCAATCTGAATCGACTTGGATCCGGCAAGGAGTCGGCGACGTCATCCAGACATAAGCATCACTACATCAGCCGAAGCAGCAGCTATCCAATGGGTGGCTACCTTACCTGAAGGTGACCCGGGAGCACTGGGATCACTCGAGCAGGTCCTACAAACAACATTCCCTACTGCTGTCTAAAGGCTGTCGTCATCCGAAGTGGTTAA

Full Affymetrix probeset data:

Annotations for 1625664_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720