Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625665_at:

>probe:Drosophila_2:1625665_at:218:355; Interrogation_Position=1016; Antisense; GCACGACTGCCCAATGAACCATTTG
>probe:Drosophila_2:1625665_at:442:165; Interrogation_Position=569; Antisense; AAATCAGGTAGCTTCGTACACGACA
>probe:Drosophila_2:1625665_at:315:299; Interrogation_Position=640; Antisense; CGCCCTTTCGGCAGAGATGGTTAAA
>probe:Drosophila_2:1625665_at:723:177; Interrogation_Position=662; Antisense; AAACTGGCTGCTCAGGATCTGCGCA
>probe:Drosophila_2:1625665_at:327:691; Interrogation_Position=694; Antisense; TTTGGACGTCCAACAGGATCTGGCC
>probe:Drosophila_2:1625665_at:365:213; Interrogation_Position=746; Antisense; AAGAGCGAACAGTTGCCCAGCATCT
>probe:Drosophila_2:1625665_at:338:115; Interrogation_Position=764; Antisense; AGCATCTCGCAGCAGACCAATGGAA
>probe:Drosophila_2:1625665_at:671:129; Interrogation_Position=794; Antisense; ACCTTGTATCGCCTGGGTGATCATA
>probe:Drosophila_2:1625665_at:654:605; Interrogation_Position=811; Antisense; TGATCATATCGACATCTCACGCGGT
>probe:Drosophila_2:1625665_at:486:229; Interrogation_Position=838; Antisense; AATGGTGGCGTCTACCAGCTTTTTG
>probe:Drosophila_2:1625665_at:698:637; Interrogation_Position=878; Antisense; TCGGCTGCCCACAAAGTTGCGGAGG
>probe:Drosophila_2:1625665_at:6:593; Interrogation_Position=913; Antisense; TGGTGCTTTCTATCGCATTCAGGGC
>probe:Drosophila_2:1625665_at:583:499; Interrogation_Position=949; Antisense; GTCTGGCTTCCAACTGAATCATGTT
>probe:Drosophila_2:1625665_at:396:415; Interrogation_Position=992; Antisense; GAGCGTTCTAAGAAACCTAGCCCCG

Paste this into a BLAST search page for me
GCACGACTGCCCAATGAACCATTTGAAATCAGGTAGCTTCGTACACGACACGCCCTTTCGGCAGAGATGGTTAAAAAACTGGCTGCTCAGGATCTGCGCATTTGGACGTCCAACAGGATCTGGCCAAGAGCGAACAGTTGCCCAGCATCTAGCATCTCGCAGCAGACCAATGGAAACCTTGTATCGCCTGGGTGATCATATGATCATATCGACATCTCACGCGGTAATGGTGGCGTCTACCAGCTTTTTGTCGGCTGCCCACAAAGTTGCGGAGGTGGTGCTTTCTATCGCATTCAGGGCGTCTGGCTTCCAACTGAATCATGTTGAGCGTTCTAAGAAACCTAGCCCCG

Full Affymetrix probeset data:

Annotations for 1625665_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime