Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625667_at:

>probe:Drosophila_2:1625667_at:32:47; Interrogation_Position=110; Antisense; ATCCCTTCATTAACATCATCCTGAG
>probe:Drosophila_2:1625667_at:702:35; Interrogation_Position=124; Antisense; ATCATCCTGAGCAGTTTCGGGAACA
>probe:Drosophila_2:1625667_at:17:381; Interrogation_Position=149; Antisense; GAACCAATGTGAACAAGTGTCCGAT
>probe:Drosophila_2:1625667_at:41:159; Interrogation_Position=161; Antisense; ACAAGTGTCCGATTCCACCGGAAAT
>probe:Drosophila_2:1625667_at:106:675; Interrogation_Position=185; Antisense; TAGTGTTGGAGCACTTTCGGTTTCC
>probe:Drosophila_2:1625667_at:289:539; Interrogation_Position=203; Antisense; GGTTTCCCGTCAAGGTTCTGGACAT
>probe:Drosophila_2:1625667_at:692:223; Interrogation_Position=214; Antisense; AAGGTTCTGGACATGATGCCCCTGC
>probe:Drosophila_2:1625667_at:592:527; Interrogation_Position=245; Antisense; GGGACTACGGACTCTTCACCACCTT
>probe:Drosophila_2:1625667_at:650:259; Interrogation_Position=277; Antisense; CACCGATCGGAGTTGGCCCAGGTTA
>probe:Drosophila_2:1625667_at:257:577; Interrogation_Position=291; Antisense; GGCCCAGGTTAAGGTGTACTTCACA
>probe:Drosophila_2:1625667_at:478:227; Interrogation_Position=34; Antisense; AAGGCCAGTGGCTATAAGCCCTTTC
>probe:Drosophila_2:1625667_at:704:31; Interrogation_Position=47; Antisense; ATAAGCCCTTTCTCTACAATATCTG
>probe:Drosophila_2:1625667_at:520:243; Interrogation_Position=64; Antisense; AATATCTGCCAGTCGGATGTGTGCG
>probe:Drosophila_2:1625667_at:17:553; Interrogation_Position=96; Antisense; GGAGAAGCGGAATCATCCCTTCATT

Paste this into a BLAST search page for me
ATCCCTTCATTAACATCATCCTGAGATCATCCTGAGCAGTTTCGGGAACAGAACCAATGTGAACAAGTGTCCGATACAAGTGTCCGATTCCACCGGAAATTAGTGTTGGAGCACTTTCGGTTTCCGGTTTCCCGTCAAGGTTCTGGACATAAGGTTCTGGACATGATGCCCCTGCGGGACTACGGACTCTTCACCACCTTCACCGATCGGAGTTGGCCCAGGTTAGGCCCAGGTTAAGGTGTACTTCACAAAGGCCAGTGGCTATAAGCCCTTTCATAAGCCCTTTCTCTACAATATCTGAATATCTGCCAGTCGGATGTGTGCGGGAGAAGCGGAATCATCCCTTCATT

Full Affymetrix probeset data:

Annotations for 1625667_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime