FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625669_at:

>probe:Drosophila_2:1625669_at:652:109; Interrogation_Position=1625; Antisense; AGAATATCCTGCAGGGCACGGCCGA
>probe:Drosophila_2:1625669_at:343:55; Interrogation_Position=1672; Antisense; ATGAAACGTCGCATTAACTCCTTCG
>probe:Drosophila_2:1625669_at:93:709; Interrogation_Position=1685; Antisense; TTAACTCCTTCGATTCATCCATGAA
>probe:Drosophila_2:1625669_at:564:41; Interrogation_Position=1701; Antisense; ATCCATGAAGGTTGCCCAAACGCGA
>probe:Drosophila_2:1625669_at:689:201; Interrogation_Position=1732; Antisense; AACCGCAGCTATCGTCCAAATGTGG
>probe:Drosophila_2:1625669_at:728:309; Interrogation_Position=1747; Antisense; CCAAATGTGGAGAACTGCCGCGATT
>probe:Drosophila_2:1625669_at:391:19; Interrogation_Position=1769; Antisense; ATTTGGCCCAGCAGGAGCTTATCGA
>probe:Drosophila_2:1625669_at:222:171; Interrogation_Position=1811; Antisense; AAAGTAGTGTATCAGCCCTTCTTCA
>probe:Drosophila_2:1625669_at:692:545; Interrogation_Position=1866; Antisense; GGATCTGGTCAATTCACGTGCTCGT
>probe:Drosophila_2:1625669_at:536:375; Interrogation_Position=1911; Antisense; GAAGAGGCGCAGTCTCTTCATCGAT
>probe:Drosophila_2:1625669_at:541:647; Interrogation_Position=1928; Antisense; TCATCGATCGGGAGCGTTGCATGCT
>probe:Drosophila_2:1625669_at:250:327; Interrogation_Position=1956; Antisense; GCGATCTTATTATCCTTCGGCTAAT
>probe:Drosophila_2:1625669_at:350:329; Interrogation_Position=1975; Antisense; GCTAATACCCTGAGTGGTGCTGCCA
>probe:Drosophila_2:1625669_at:72:427; Interrogation_Position=2069; Antisense; GAGATCTAAATTACCCAGTGCTCCT

Paste this into a BLAST search page for me
AGAATATCCTGCAGGGCACGGCCGAATGAAACGTCGCATTAACTCCTTCGTTAACTCCTTCGATTCATCCATGAAATCCATGAAGGTTGCCCAAACGCGAAACCGCAGCTATCGTCCAAATGTGGCCAAATGTGGAGAACTGCCGCGATTATTTGGCCCAGCAGGAGCTTATCGAAAAGTAGTGTATCAGCCCTTCTTCAGGATCTGGTCAATTCACGTGCTCGTGAAGAGGCGCAGTCTCTTCATCGATTCATCGATCGGGAGCGTTGCATGCTGCGATCTTATTATCCTTCGGCTAATGCTAATACCCTGAGTGGTGCTGCCAGAGATCTAAATTACCCAGTGCTCCT

Full Affymetrix probeset data:

Annotations for 1625669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720