FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625670_at:

>probe:Drosophila_2:1625670_at:117:211; Interrogation_Position=2878; Antisense; AAGAAGACAGCAGCTGCTACTGCAA
>probe:Drosophila_2:1625670_at:544:351; Interrogation_Position=2905; Antisense; GCAGCACCCCTAACAGCGAAGCGGA
>probe:Drosophila_2:1625670_at:673:323; Interrogation_Position=2932; Antisense; GCGCAGCATATAGTGTTAACGGCAA
>probe:Drosophila_2:1625670_at:8:177; Interrogation_Position=3053; Antisense; AAACGCTGACGGTGGCAGCTCAGCA
>probe:Drosophila_2:1625670_at:401:113; Interrogation_Position=3077; Antisense; AGCAGCAATCGCGTAACGGTAACTC
>probe:Drosophila_2:1625670_at:79:493; Interrogation_Position=3089; Antisense; GTAACGGTAACTCGCTGCTTGGCTA
>probe:Drosophila_2:1625670_at:410:335; Interrogation_Position=3102; Antisense; GCTGCTTGGCTATCGGCGCGAAACG
>probe:Drosophila_2:1625670_at:430:295; Interrogation_Position=3120; Antisense; CGAAACGGTTAACCGCGCAGCGGCA
>probe:Drosophila_2:1625670_at:240:105; Interrogation_Position=3168; Antisense; AGACGAGCCGCTGTCGCAGTTGCAG
>probe:Drosophila_2:1625670_at:167:121; Interrogation_Position=3239; Antisense; AGCGGCGCCAGTTTCACTGTCCATA
>probe:Drosophila_2:1625670_at:542:67; Interrogation_Position=3270; Antisense; ATGGCGTCCCAGCTACTGAGTGTTC
>probe:Drosophila_2:1625670_at:354:83; Interrogation_Position=3288; Antisense; AGTGTTCACTGTATCCCGTTATGCC
>probe:Drosophila_2:1625670_at:707:133; Interrogation_Position=3323; Antisense; ACCCACTTACTCTCGCAAATTGTTC
>probe:Drosophila_2:1625670_at:686:161; Interrogation_Position=3339; Antisense; AAATTGTTCCCACCCATGAGCCAGA

Paste this into a BLAST search page for me
AAGAAGACAGCAGCTGCTACTGCAAGCAGCACCCCTAACAGCGAAGCGGAGCGCAGCATATAGTGTTAACGGCAAAAACGCTGACGGTGGCAGCTCAGCAAGCAGCAATCGCGTAACGGTAACTCGTAACGGTAACTCGCTGCTTGGCTAGCTGCTTGGCTATCGGCGCGAAACGCGAAACGGTTAACCGCGCAGCGGCAAGACGAGCCGCTGTCGCAGTTGCAGAGCGGCGCCAGTTTCACTGTCCATAATGGCGTCCCAGCTACTGAGTGTTCAGTGTTCACTGTATCCCGTTATGCCACCCACTTACTCTCGCAAATTGTTCAAATTGTTCCCACCCATGAGCCAGA

Full Affymetrix probeset data:

Annotations for 1625670_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720