Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625671_at:

>probe:Drosophila_2:1625671_at:193:555; Interrogation_Position=316; Antisense; GGACCTCCGGCAATGATTTGGGCAA
>probe:Drosophila_2:1625671_at:618:309; Interrogation_Position=350; Antisense; CCACTACTGGTTCTCTAATGCACAA
>probe:Drosophila_2:1625671_at:161:611; Interrogation_Position=379; Antisense; TGACCATTAAGCGTTGGGCGCCCAA
>probe:Drosophila_2:1625671_at:382:551; Interrogation_Position=428; Antisense; GGAGCATTGCATACACTTGGGCTAC
>probe:Drosophila_2:1625671_at:707:593; Interrogation_Position=445; Antisense; TGGGCTACATCTACGGCTATTCAAC
>probe:Drosophila_2:1625671_at:726:469; Interrogation_Position=473; Antisense; GTTCCAACTGAATGATCGACCCTGC
>probe:Drosophila_2:1625671_at:53:209; Interrogation_Position=552; Antisense; AAGCAGTACTACATTTCGTTGGCAA
>probe:Drosophila_2:1625671_at:258:471; Interrogation_Position=587; Antisense; GTTCGAGGCAAGCAACCACTGTCGT
>probe:Drosophila_2:1625671_at:271:369; Interrogation_Position=614; Antisense; GAATGGCGGATTTCTTCTCAATTTG
>probe:Drosophila_2:1625671_at:414:683; Interrogation_Position=700; Antisense; TATCCATCAATGACCTCGGCGAACG
>probe:Drosophila_2:1625671_at:182:29; Interrogation_Position=731; Antisense; ATACGTGTCGGAGGCCACTGGTCTA
>probe:Drosophila_2:1625671_at:454:677; Interrogation_Position=754; Antisense; TAGAGGCTCCGTTTCTTAACTGGTC
>probe:Drosophila_2:1625671_at:544:95; Interrogation_Position=850; Antisense; AGATGAACGACCTCCCATGCTATAG
>probe:Drosophila_2:1625671_at:52:631; Interrogation_Position=880; Antisense; TCGCCTTCATTTGCCAGCTTAACTA

Paste this into a BLAST search page for me
GGACCTCCGGCAATGATTTGGGCAACCACTACTGGTTCTCTAATGCACAATGACCATTAAGCGTTGGGCGCCCAAGGAGCATTGCATACACTTGGGCTACTGGGCTACATCTACGGCTATTCAACGTTCCAACTGAATGATCGACCCTGCAAGCAGTACTACATTTCGTTGGCAAGTTCGAGGCAAGCAACCACTGTCGTGAATGGCGGATTTCTTCTCAATTTGTATCCATCAATGACCTCGGCGAACGATACGTGTCGGAGGCCACTGGTCTATAGAGGCTCCGTTTCTTAACTGGTCAGATGAACGACCTCCCATGCTATAGTCGCCTTCATTTGCCAGCTTAACTA

Full Affymetrix probeset data:

Annotations for 1625671_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime