Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625672_s_at:

>probe:Drosophila_2:1625672_s_at:71:317; Interrogation_Position=123; Antisense; GCCGATCATCGTACCGCAAAAGGGA
>probe:Drosophila_2:1625672_s_at:103:519; Interrogation_Position=160; Antisense; GTGGTACTACAGCAGTCGAGCTCCT
>probe:Drosophila_2:1625672_s_at:306:631; Interrogation_Position=181; Antisense; TCCTCGTTGAGCTCCTGGTTTAAGT
>probe:Drosophila_2:1625672_s_at:314:535; Interrogation_Position=197; Antisense; GGTTTAAGTCGAACTCCCAACTGAG
>probe:Drosophila_2:1625672_s_at:33:687; Interrogation_Position=20; Antisense; TATACGCCTTTACATTGCAGCCAAG
>probe:Drosophila_2:1625672_s_at:241:195; Interrogation_Position=215; Antisense; AACTGAGCTCCTGGTCGAGTTCTTC
>probe:Drosophila_2:1625672_s_at:496:717; Interrogation_Position=237; Antisense; TTCGCTTCAGCGTTTTTATCGTAAA
>probe:Drosophila_2:1625672_s_at:307:59; Interrogation_Position=329; Antisense; ATGATCAGAGTTCCAGTCCGTGCAA
>probe:Drosophila_2:1625672_s_at:261:509; Interrogation_Position=348; Antisense; GTGCAATTACGCTTTTCAGAACCTC
>probe:Drosophila_2:1625672_s_at:315:255; Interrogation_Position=374; Antisense; CAAAAACTAATCTGCACGTGTCTAA
>probe:Drosophila_2:1625672_s_at:368:139; Interrogation_Position=389; Antisense; ACGTGTCTAAATCTGGCTGCCATGC
>probe:Drosophila_2:1625672_s_at:691:627; Interrogation_Position=411; Antisense; TGCCAGGCGCGACATCAATCATATT
>probe:Drosophila_2:1625672_s_at:654:379; Interrogation_Position=44; Antisense; GAAGCCTCTTAGTGCATATTCAACT
>probe:Drosophila_2:1625672_s_at:294:193; Interrogation_Position=65; Antisense; AACTACCAGCACAGAGCTTCTCAAT

Paste this into a BLAST search page for me
GCCGATCATCGTACCGCAAAAGGGAGTGGTACTACAGCAGTCGAGCTCCTTCCTCGTTGAGCTCCTGGTTTAAGTGGTTTAAGTCGAACTCCCAACTGAGTATACGCCTTTACATTGCAGCCAAGAACTGAGCTCCTGGTCGAGTTCTTCTTCGCTTCAGCGTTTTTATCGTAAAATGATCAGAGTTCCAGTCCGTGCAAGTGCAATTACGCTTTTCAGAACCTCCAAAAACTAATCTGCACGTGTCTAAACGTGTCTAAATCTGGCTGCCATGCTGCCAGGCGCGACATCAATCATATTGAAGCCTCTTAGTGCATATTCAACTAACTACCAGCACAGAGCTTCTCAAT

Full Affymetrix probeset data:

Annotations for 1625672_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime