FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625673_at:

>probe:Drosophila_2:1625673_at:431:429; Interrogation_Position=476; Antisense; GAGTTCTCCGTAACGACGATGAGCT
>probe:Drosophila_2:1625673_at:334:445; Interrogation_Position=493; Antisense; GATGAGCTCGTACATTTGCCAACAT
>probe:Drosophila_2:1625673_at:48:313; Interrogation_Position=510; Antisense; GCCAACATTTCAAGTCCGTGAGCTG
>probe:Drosophila_2:1625673_at:599:277; Interrogation_Position=576; Antisense; CTTTGACAAACTGACCTATCGCGTG
>probe:Drosophila_2:1625673_at:682:643; Interrogation_Position=602; Antisense; TCTCTTCTCCTGATGCCTTAATGAT
>probe:Drosophila_2:1625673_at:553:483; Interrogation_Position=638; Antisense; GTATCTTGTCATGCTACTGCTATAA
>probe:Drosophila_2:1625673_at:109:153; Interrogation_Position=696; Antisense; ACAGGATGTACCCATTCGTTTCAAT
>probe:Drosophila_2:1625673_at:576:497; Interrogation_Position=733; Antisense; GTCATTGACTTAATGGCACTGCCTG
>probe:Drosophila_2:1625673_at:671:15; Interrogation_Position=775; Antisense; ATTTTCAGGCTACCCGTAATGTGCT
>probe:Drosophila_2:1625673_at:232:657; Interrogation_Position=791; Antisense; TAATGTGCTCCGATCTGAACTGCGT
>probe:Drosophila_2:1625673_at:245:517; Interrogation_Position=818; Antisense; GTGTGACTATTCAACTGCCACTCAG
>probe:Drosophila_2:1625673_at:476:627; Interrogation_Position=833; Antisense; TGCCACTCAGTGTGCTTTGCGACAA
>probe:Drosophila_2:1625673_at:578:693; Interrogation_Position=848; Antisense; TTTGCGACAATCTTACACTGCGGTG
>probe:Drosophila_2:1625673_at:322:177; Interrogation_Position=948; Antisense; AAACTGTGGTCTGGTGGATATCGCA

Paste this into a BLAST search page for me
GAGTTCTCCGTAACGACGATGAGCTGATGAGCTCGTACATTTGCCAACATGCCAACATTTCAAGTCCGTGAGCTGCTTTGACAAACTGACCTATCGCGTGTCTCTTCTCCTGATGCCTTAATGATGTATCTTGTCATGCTACTGCTATAAACAGGATGTACCCATTCGTTTCAATGTCATTGACTTAATGGCACTGCCTGATTTTCAGGCTACCCGTAATGTGCTTAATGTGCTCCGATCTGAACTGCGTGTGTGACTATTCAACTGCCACTCAGTGCCACTCAGTGTGCTTTGCGACAATTTGCGACAATCTTACACTGCGGTGAAACTGTGGTCTGGTGGATATCGCA

Full Affymetrix probeset data:

Annotations for 1625673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720