FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625674_at:

>probe:Drosophila_2:1625674_at:225:591; Interrogation_Position=296; Antisense; TGGTCGAATCTCTACAGGATCCCTT
>probe:Drosophila_2:1625674_at:310:449; Interrogation_Position=313; Antisense; GATCCCTTTGCCTTAGATGCGGTTG
>probe:Drosophila_2:1625674_at:644:621; Interrogation_Position=330; Antisense; TGCGGTTGCCGTGATCTTGGTACAA
>probe:Drosophila_2:1625674_at:469:11; Interrogation_Position=391; Antisense; ATTCTGATGAAACCCTTGGATGCCA
>probe:Drosophila_2:1625674_at:307:533; Interrogation_Position=417; Antisense; GGTGGCCAATCATCCGTGCTACAAG
>probe:Drosophila_2:1625674_at:511:339; Interrogation_Position=434; Antisense; GCTACAAGCGCACTCTGATGAAGAT
>probe:Drosophila_2:1625674_at:374:25; Interrogation_Position=484; Antisense; ATAGGTCCTTCAGATCGTGTCTTAC
>probe:Drosophila_2:1625674_at:225:49; Interrogation_Position=512; Antisense; ATGCCACGCCCATAATGGTGCGGGA
>probe:Drosophila_2:1625674_at:527:329; Interrogation_Position=531; Antisense; GCGGGACATACCACACAAATTTCTG
>probe:Drosophila_2:1625674_at:703:573; Interrogation_Position=556; Antisense; GGCGATGGACCCACTGGCATTATAA
>probe:Drosophila_2:1625674_at:640:659; Interrogation_Position=578; Antisense; TAACCATGCATATTTTTCGCACCCC
>probe:Drosophila_2:1625674_at:420:445; Interrogation_Position=705; Antisense; GATGAATCTACTCGATACCTTTAAG
>probe:Drosophila_2:1625674_at:203:477; Interrogation_Position=737; Antisense; GTTTCACGGTCGATATGGAGCCCAT
>probe:Drosophila_2:1625674_at:136:477; Interrogation_Position=809; Antisense; GTTATCACTATGAAACCCTGCCCAT

Paste this into a BLAST search page for me
TGGTCGAATCTCTACAGGATCCCTTGATCCCTTTGCCTTAGATGCGGTTGTGCGGTTGCCGTGATCTTGGTACAAATTCTGATGAAACCCTTGGATGCCAGGTGGCCAATCATCCGTGCTACAAGGCTACAAGCGCACTCTGATGAAGATATAGGTCCTTCAGATCGTGTCTTACATGCCACGCCCATAATGGTGCGGGAGCGGGACATACCACACAAATTTCTGGGCGATGGACCCACTGGCATTATAATAACCATGCATATTTTTCGCACCCCGATGAATCTACTCGATACCTTTAAGGTTTCACGGTCGATATGGAGCCCATGTTATCACTATGAAACCCTGCCCAT

Full Affymetrix probeset data:

Annotations for 1625674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720