FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625678_at:

>probe:Drosophila_2:1625678_at:291:35; Interrogation_Position=2658; Antisense; ATCACCACGAGTTCCGCAAGCAGTG
>probe:Drosophila_2:1625678_at:158:361; Interrogation_Position=2673; Antisense; GCAAGCAGTGCTACACGGCGTACCT
>probe:Drosophila_2:1625678_at:518:47; Interrogation_Position=2712; Antisense; ATGCCAACGTGATGCTCAACCTGTT
>probe:Drosophila_2:1625678_at:662:253; Interrogation_Position=2728; Antisense; CAACCTGTTCTCTCTGATGGTGGAC
>probe:Drosophila_2:1625678_at:318:65; Interrogation_Position=2744; Antisense; ATGGTGGACGCCACTGTGCCGGATA
>probe:Drosophila_2:1625678_at:452:75; Interrogation_Position=2805; Antisense; AGGAGAACCTGCAGCTGGGCCTCAC
>probe:Drosophila_2:1625678_at:113:569; Interrogation_Position=2839; Antisense; GGCAGTGCAGCACTTGCAGAGCCTC
>probe:Drosophila_2:1625678_at:17:409; Interrogation_Position=2867; Antisense; GACGTGTCCATTACGGCGGTGATGC
>probe:Drosophila_2:1625678_at:690:551; Interrogation_Position=2902; Antisense; GGAGCAGATTCATCGGTTCACCCAA
>probe:Drosophila_2:1625678_at:198:541; Interrogation_Position=2916; Antisense; GGTTCACCCAATACTGGCGGAAGTA
>probe:Drosophila_2:1625678_at:389:493; Interrogation_Position=2979; Antisense; GTAATCCTAGTTCGGTTCAGCTGAG
>probe:Drosophila_2:1625678_at:635:723; Interrogation_Position=3095; Antisense; TTGCTTTAGTCGTAGGTGGCCTGTA
>probe:Drosophila_2:1625678_at:642:531; Interrogation_Position=3109; Antisense; GGTGGCCTGTAGCTAAAAGTCCGTT
>probe:Drosophila_2:1625678_at:274:631; Interrogation_Position=3128; Antisense; TCCGTTGTGCGGAACCAAATGTATC

Paste this into a BLAST search page for me
ATCACCACGAGTTCCGCAAGCAGTGGCAAGCAGTGCTACACGGCGTACCTATGCCAACGTGATGCTCAACCTGTTCAACCTGTTCTCTCTGATGGTGGACATGGTGGACGCCACTGTGCCGGATAAGGAGAACCTGCAGCTGGGCCTCACGGCAGTGCAGCACTTGCAGAGCCTCGACGTGTCCATTACGGCGGTGATGCGGAGCAGATTCATCGGTTCACCCAAGGTTCACCCAATACTGGCGGAAGTAGTAATCCTAGTTCGGTTCAGCTGAGTTGCTTTAGTCGTAGGTGGCCTGTAGGTGGCCTGTAGCTAAAAGTCCGTTTCCGTTGTGCGGAACCAAATGTATC

Full Affymetrix probeset data:

Annotations for 1625678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720