FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625679_at:

>probe:Drosophila_2:1625679_at:450:313; Interrogation_Position=129; Antisense; GCCAGCTACGGCGTTTATTATCGCA
>probe:Drosophila_2:1625679_at:209:637; Interrogation_Position=164; Antisense; TCGAGAGTTTCGTCAGCATATTCAC
>probe:Drosophila_2:1625679_at:225:385; Interrogation_Position=191; Antisense; GAACTATCCCTTCGTTTTGGACTAT
>probe:Drosophila_2:1625679_at:595:159; Interrogation_Position=23; Antisense; ACAACTCCCACTTAAAATGCTGCGC
>probe:Drosophila_2:1625679_at:46:99; Interrogation_Position=301; Antisense; AGAGGAGACCGCTTCCAAAATGCTT
>probe:Drosophila_2:1625679_at:411:217; Interrogation_Position=341; Antisense; AAGTCCGTTTTGTGGCTGATTGGCT
>probe:Drosophila_2:1625679_at:721:43; Interrogation_Position=39; Antisense; ATGCTGCGCAAAACACCAAAACCTG
>probe:Drosophila_2:1625679_at:592:89; Interrogation_Position=390; Antisense; TGGTGTTAACCGAGCCGAACGTCGA
>probe:Drosophila_2:1625679_at:125:475; Interrogation_Position=418; Antisense; GTTAGAGCGCATCAAAGCCTCCGTT
>probe:Drosophila_2:1625679_at:694:125; Interrogation_Position=433; Antisense; AGCCTCCGTTTCAAGTACCAAACTG
>probe:Drosophila_2:1625679_at:430:353; Interrogation_Position=469; Antisense; GCAGCGAAAGGCTCTGTTTATGAAG
>probe:Drosophila_2:1625679_at:246:239; Interrogation_Position=526; Antisense; AATCTACAGGTCATCGTCCGAGAAA
>probe:Drosophila_2:1625679_at:193:475; Interrogation_Position=558; Antisense; GTTAGGAAGCTTAATCGTCATCAAT
>probe:Drosophila_2:1625679_at:592:181; Interrogation_Position=93; Antisense; AAAACACTGTTTGTCCTCGAGGCAG

Paste this into a BLAST search page for me
GCCAGCTACGGCGTTTATTATCGCATCGAGAGTTTCGTCAGCATATTCACGAACTATCCCTTCGTTTTGGACTATACAACTCCCACTTAAAATGCTGCGCAGAGGAGACCGCTTCCAAAATGCTTAAGTCCGTTTTGTGGCTGATTGGCTATGCTGCGCAAAACACCAAAACCTGTGGTGTTAACCGAGCCGAACGTCGAGTTAGAGCGCATCAAAGCCTCCGTTAGCCTCCGTTTCAAGTACCAAACTGGCAGCGAAAGGCTCTGTTTATGAAGAATCTACAGGTCATCGTCCGAGAAAGTTAGGAAGCTTAATCGTCATCAATAAAACACTGTTTGTCCTCGAGGCAG

Full Affymetrix probeset data:

Annotations for 1625679_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720