Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625680_a_at:

>probe:Drosophila_2:1625680_a_at:140:163; Interrogation_Position=1039; Antisense; AAATTCGTCAACTACCGTCTGCAGC
>probe:Drosophila_2:1625680_a_at:501:113; Interrogation_Position=1061; Antisense; AGCAGGATCGTGCACAAGCTCTGTT
>probe:Drosophila_2:1625680_a_at:157:415; Interrogation_Position=1092; Antisense; GACCACCAAGATGCTTCATGTTCGC
>probe:Drosophila_2:1625680_a_at:95:269; Interrogation_Position=1108; Antisense; CATGTTCGCATTCCAGTGTTCAGTA
>probe:Drosophila_2:1625680_a_at:72:235; Interrogation_Position=1156; Antisense; AATGCCCGCTGTGATAATGTTAATA
>probe:Drosophila_2:1625680_a_at:393:217; Interrogation_Position=670; Antisense; AAGTTCATCGGCACTTTGGTCACTC
>probe:Drosophila_2:1625680_a_at:43:539; Interrogation_Position=687; Antisense; GGTCACTCATCGTGTGCGCAACGAA
>probe:Drosophila_2:1625680_a_at:141:55; Interrogation_Position=715; Antisense; ATGAAAAGGGCCCAGTCTACGTCCG
>probe:Drosophila_2:1625680_a_at:542:409; Interrogation_Position=817; Antisense; GACGAGAAGGATGCTGCTGCCATAA
>probe:Drosophila_2:1625680_a_at:482:69; Interrogation_Position=861; Antisense; AGGCGGCGGTTTTCTGGATATACAG
>probe:Drosophila_2:1625680_a_at:168:179; Interrogation_Position=889; Antisense; AAACTTCGTGGTCGAGTTCGTGACG
>probe:Drosophila_2:1625680_a_at:537:87; Interrogation_Position=914; Antisense; AGTCCGTTGACGAAATCCATGCTGA
>probe:Drosophila_2:1625680_a_at:214:53; Interrogation_Position=932; Antisense; ATGCTGAGATCTACTTGCCCAACTA
>probe:Drosophila_2:1625680_a_at:252:645; Interrogation_Position=955; Antisense; TACGTTTCTTCGCAGGAGTTCAGTC

Paste this into a BLAST search page for me
AAATTCGTCAACTACCGTCTGCAGCAGCAGGATCGTGCACAAGCTCTGTTGACCACCAAGATGCTTCATGTTCGCCATGTTCGCATTCCAGTGTTCAGTAAATGCCCGCTGTGATAATGTTAATAAAGTTCATCGGCACTTTGGTCACTCGGTCACTCATCGTGTGCGCAACGAAATGAAAAGGGCCCAGTCTACGTCCGGACGAGAAGGATGCTGCTGCCATAAAGGCGGCGGTTTTCTGGATATACAGAAACTTCGTGGTCGAGTTCGTGACGAGTCCGTTGACGAAATCCATGCTGAATGCTGAGATCTACTTGCCCAACTATACGTTTCTTCGCAGGAGTTCAGTC

Full Affymetrix probeset data:

Annotations for 1625680_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime