Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625681_at:

>probe:Drosophila_2:1625681_at:127:89; Interrogation_Position=1772; Antisense; AGTCTGAACTTCACCAGCGATCGGC
>probe:Drosophila_2:1625681_at:526:305; Interrogation_Position=1797; Antisense; CCGGCCATCGTGTGTCGGTGATTGT
>probe:Drosophila_2:1625681_at:624:533; Interrogation_Position=1813; Antisense; GGTGATTGTGATATCGGCTCAGAAC
>probe:Drosophila_2:1625681_at:94:261; Interrogation_Position=1847; Antisense; CAGCCAGTGCGCGACTTTCAGTTCG
>probe:Drosophila_2:1625681_at:459:211; Interrogation_Position=1883; Antisense; AAGAAGCCCTGCAAGGTGCGCCTGT
>probe:Drosophila_2:1625681_at:610:337; Interrogation_Position=1984; Antisense; GCTAAATCCGACAGGCAAGGCCGTG
>probe:Drosophila_2:1625681_at:155:69; Interrogation_Position=2001; Antisense; AGGCCGTGGACGTAACATGCATTGT
>probe:Drosophila_2:1625681_at:445:593; Interrogation_Position=2025; Antisense; TGGGCTACAAGCTGGGCGACGATCC
>probe:Drosophila_2:1625681_at:104:297; Interrogation_Position=2041; Antisense; CGACGATCCGGATCCCATCAAGGAA
>probe:Drosophila_2:1625681_at:591:519; Interrogation_Position=2093; Antisense; GTGGACTAAAATACCCCGACATATA
>probe:Drosophila_2:1625681_at:601:633; Interrogation_Position=2130; Antisense; TCCCGTCCACTGAAAGCGCAGGAGG
>probe:Drosophila_2:1625681_at:318:211; Interrogation_Position=2171; Antisense; AAGACAGTCAATTTTCCCGCATCTA
>probe:Drosophila_2:1625681_at:670:243; Interrogation_Position=2180; Antisense; AATTTTCCCGCATCTATGTTGTGCT
>probe:Drosophila_2:1625681_at:533:467; Interrogation_Position=2197; Antisense; GTTGTGCTCCCCATTATCTTAAAGA

Paste this into a BLAST search page for me
AGTCTGAACTTCACCAGCGATCGGCCCGGCCATCGTGTGTCGGTGATTGTGGTGATTGTGATATCGGCTCAGAACCAGCCAGTGCGCGACTTTCAGTTCGAAGAAGCCCTGCAAGGTGCGCCTGTGCTAAATCCGACAGGCAAGGCCGTGAGGCCGTGGACGTAACATGCATTGTTGGGCTACAAGCTGGGCGACGATCCCGACGATCCGGATCCCATCAAGGAAGTGGACTAAAATACCCCGACATATATCCCGTCCACTGAAAGCGCAGGAGGAAGACAGTCAATTTTCCCGCATCTAAATTTTCCCGCATCTATGTTGTGCTGTTGTGCTCCCCATTATCTTAAAGA

Full Affymetrix probeset data:

Annotations for 1625681_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime