FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625683_at:

>probe:Drosophila_2:1625683_at:52:251; Interrogation_Position=1190; Antisense; CAATCTGCTGTTGGGCAATGGCGCC
>probe:Drosophila_2:1625683_at:446:323; Interrogation_Position=1210; Antisense; GCGCCGAGCTCAATCCATTTGTGGA
>probe:Drosophila_2:1625683_at:185:219; Interrogation_Position=1259; Antisense; AAGTGACTACAGCATGGCGGCCATT
>probe:Drosophila_2:1625683_at:439:579; Interrogation_Position=1277; Antisense; GGCCATTTATGGTCTGATCGACAGT
>probe:Drosophila_2:1625683_at:204:451; Interrogation_Position=1292; Antisense; GATCGACAGTGTGCTGCCCAAGGAA
>probe:Drosophila_2:1625683_at:706:307; Interrogation_Position=1345; Antisense; CCAAGTGCAAGAAGTCCGTCCAGGA
>probe:Drosophila_2:1625683_at:6:327; Interrogation_Position=1378; Antisense; GCGACGATGGTGTGCTGTTCTTTCA
>probe:Drosophila_2:1625683_at:374:145; Interrogation_Position=1429; Antisense; ACTACTATCCTCTGGTCAAGTTCAA
>probe:Drosophila_2:1625683_at:660:473; Interrogation_Position=1448; Antisense; GTTCAATGACTTCGCGTACTTCAGC
>probe:Drosophila_2:1625683_at:704:489; Interrogation_Position=1463; Antisense; GTACTTCAGCCTCTTCAATGTGCTC
>probe:Drosophila_2:1625683_at:320:383; Interrogation_Position=1599; Antisense; GAACTGGAGCGCACTTTTGGCGGCT
>probe:Drosophila_2:1625683_at:28:533; Interrogation_Position=1624; Antisense; GGGTGCCTCCATTTCCGCTGAAGAA
>probe:Drosophila_2:1625683_at:595:529; Interrogation_Position=1704; Antisense; GGGTAACGCTGAAGACTGTCGCTTT
>probe:Drosophila_2:1625683_at:695:1; Interrogation_Position=1761; Antisense; ATTGGCTATCTTTTTTAACTGCTTG

Paste this into a BLAST search page for me
CAATCTGCTGTTGGGCAATGGCGCCGCGCCGAGCTCAATCCATTTGTGGAAAGTGACTACAGCATGGCGGCCATTGGCCATTTATGGTCTGATCGACAGTGATCGACAGTGTGCTGCCCAAGGAACCAAGTGCAAGAAGTCCGTCCAGGAGCGACGATGGTGTGCTGTTCTTTCAACTACTATCCTCTGGTCAAGTTCAAGTTCAATGACTTCGCGTACTTCAGCGTACTTCAGCCTCTTCAATGTGCTCGAACTGGAGCGCACTTTTGGCGGCTGGGTGCCTCCATTTCCGCTGAAGAAGGGTAACGCTGAAGACTGTCGCTTTATTGGCTATCTTTTTTAACTGCTTG

Full Affymetrix probeset data:

Annotations for 1625683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720