FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625685_at:

>probe:Drosophila_2:1625685_at:94:35; Interrogation_Position=2219; Antisense; ATCACTGTCCCTACATTCAGGAGTT
>probe:Drosophila_2:1625685_at:205:477; Interrogation_Position=2241; Antisense; GTTTACCTGGCGCAGCAAGAACGTG
>probe:Drosophila_2:1625685_at:241:383; Interrogation_Position=2259; Antisense; GAACGTGATAGTGCGCGGATCTCAT
>probe:Drosophila_2:1625685_at:350:323; Interrogation_Position=2271; Antisense; GCGCGGATCTCATTGTCGATTTACA
>probe:Drosophila_2:1625685_at:12:575; Interrogation_Position=2309; Antisense; GGCCTGAAAAGAACTTCGCCTTGGA
>probe:Drosophila_2:1625685_at:142:593; Interrogation_Position=2380; Antisense; TGGGAGGAGCGATCCTGTCACCAGA
>probe:Drosophila_2:1625685_at:724:261; Interrogation_Position=2398; Antisense; CACCAGACGCGTGAGTGGCAGCATT
>probe:Drosophila_2:1625685_at:249:185; Interrogation_Position=2440; Antisense; AAGTACGATTGCTTCGACGGGCGAC
>probe:Drosophila_2:1625685_at:520:573; Interrogation_Position=2459; Antisense; GGCGACTGCACATCCTGGTGGGCAA
>probe:Drosophila_2:1625685_at:673:147; Interrogation_Position=2483; Antisense; ACTATAGCTACAAGTGCTCCTTTCC
>probe:Drosophila_2:1625685_at:221:117; Interrogation_Position=2516; Antisense; AGCTTTCTATTCGAATTGCGGCCAA
>probe:Drosophila_2:1625685_at:139:441; Interrogation_Position=2543; Antisense; GATGGCTGCACAAGGGCGCGATCAT
>probe:Drosophila_2:1625685_at:621:423; Interrogation_Position=2695; Antisense; GAGAAATCACGTTCCGTGGCCATAA
>probe:Drosophila_2:1625685_at:428:31; Interrogation_Position=2716; Antisense; ATAATCACCGCTGTACTGCTGCTTT

Paste this into a BLAST search page for me
ATCACTGTCCCTACATTCAGGAGTTGTTTACCTGGCGCAGCAAGAACGTGGAACGTGATAGTGCGCGGATCTCATGCGCGGATCTCATTGTCGATTTACAGGCCTGAAAAGAACTTCGCCTTGGATGGGAGGAGCGATCCTGTCACCAGACACCAGACGCGTGAGTGGCAGCATTAAGTACGATTGCTTCGACGGGCGACGGCGACTGCACATCCTGGTGGGCAAACTATAGCTACAAGTGCTCCTTTCCAGCTTTCTATTCGAATTGCGGCCAAGATGGCTGCACAAGGGCGCGATCATGAGAAATCACGTTCCGTGGCCATAAATAATCACCGCTGTACTGCTGCTTT

Full Affymetrix probeset data:

Annotations for 1625685_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720